View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11841_low_24 (Length: 242)
Name: NF11841_low_24
Description: NF11841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11841_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 39480374 - 39480137
Alignment:
| Q |
1 |
agcaagcaatagcaaagaacttgagctggtttacctctctggtggggatagtgagagtcaattttgcctcaaagggtctcttccaaaggacaaagttcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39480374 |
agcaagcaatagcaaagaacttgagctggtttacctctctggtggggatagtgagagtcaattttgcctcaaagggtctcttccaaaggacaaagttcaa |
39480275 |
T |
 |
| Q |
101 |
ggaaaaatggtggtatgtgatcgaggtgtcaacggaagatcagaaaagggtcaagctgtgaaggaagcaggcggtgctgctatgatcttggcaaacacag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39480274 |
ggaaaaatggtggtatgtgatcgaggtgtcaacggaagatcagaaaagggtcaagctgtgaaggaagcaggtggtgctgctatgatcttggcaaacacag |
39480175 |
T |
 |
| Q |
201 |
agctaaacttggaagaagattcggttgatgtccatctc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39480174 |
agctaaacttggaagaagattcggttgatgttcatctc |
39480137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 39127053 - 39127281
Alignment:
| Q |
1 |
agcaagcaatagcaaagaacttgagctggtttacctctctggtggggatagtgagagtcaattttgcctcaaagggtctcttccaaaggacaaagttcaa |
100 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||| |||||| |||||||||||||||||| ||||||| ||||||||||||| |||| ||||| |
|
|
| T |
39127053 |
agcaagcaatggcaaagaacttgagccggtttacctaagtggtggagatagtgagagtcaattt-gcctcaatac-tctcttccaaaggtcaaatttcaa |
39127150 |
T |
 |
| Q |
101 |
ggaaaaatggtggtatgtgatcgaggtgtcaacggaagatcagaaaagggtcaagctgtgaaggaagcaggcggtgctgctatgatcttggcaaacacag |
200 |
Q |
| |
|
|| |||| ||| |||| ||| |||||||||| |||||||||||||||||||||| |||||| |||||| | || |||||||||||||||||||||||| |
|
|
| T |
39127151 |
ggcaaaacggtcatatgcgattgaggtgtcaatggaagatcagaaaagggtcaagttgtgaatgaagcaagtagtactgctatgatcttggcaaacacag |
39127250 |
T |
 |
| Q |
201 |
agctaaacttggaagaagattcggttgatgt |
231 |
Q |
| |
|
|||| ||||||||||||||||| ||||||| |
|
|
| T |
39127251 |
agcttaacttggaagaagattcaattgatgt |
39127281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University