View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11841_low_25 (Length: 241)
Name: NF11841_low_25
Description: NF11841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11841_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 17 - 222
Target Start/End: Complemental strand, 37215810 - 37215605
Alignment:
| Q |
17 |
gagatcaatgggacaaggcagcgttgctagatcatggtaatcgacgcgagggattggatgagacactacaaagctggattcttgaaaggccaaatatgaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37215810 |
gagatcaatgggacaaggcagcgttgctcgatcatggtaatcgacgcgagggattggatgagacactacaaagctggattcttgaaaggccaaatatgaa |
37215711 |
T |
 |
| Q |
117 |
gaagaagaccaagtatgtggattttggatgcatcgtgttgagtcacaaggcattgaaatggatttttggtataatctttgtgggtttttgtgcaattggt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37215710 |
gaagaagaccaagtatgtggattttggatgcatcgtgttgagtcacaaggcattgaaatggatttttggtataatctttgtgggtttttgtgcaattggt |
37215611 |
T |
 |
| Q |
217 |
cttcct |
222 |
Q |
| |
|
|||||| |
|
|
| T |
37215610 |
cttcct |
37215605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University