View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11841_low_27 (Length: 238)
Name: NF11841_low_27
Description: NF11841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11841_low_27 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 22 - 238
Target Start/End: Complemental strand, 1786872 - 1786654
Alignment:
| Q |
22 |
ctaacacaagacttcttttaccacaattattaatctacatgtcatgttgtaccaaaaccgcaaatta--atatatgtttcgattactagtgaatttgaca |
119 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |||||||| ||||||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1786872 |
ctaacacaagactccttttaccacaattattaatctacgtgtcatgtcgtaccaaaaccaaaaattagtatatatgtttcgattactagtgaatttgaca |
1786773 |
T |
|
| Q |
120 |
aaattacggtatcacatttttaacaaaatcacggtgtcatcatataattctgtcaactttatggcaattctaagcattatactcaatgtgtttaagatgt |
219 |
Q |
| |
|
||||| || ||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
1786772 |
aaatttcgatatcacaattttaacaaaatcaaggtgtcatcatataattctgtcaactttatggcaattctaagcattgtactcaatttgtttaagatgt |
1786673 |
T |
|
| Q |
220 |
taataaagattgaccttga |
238 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
1786672 |
taataaagattgaccttga |
1786654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University