View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11841_low_8 (Length: 409)
Name: NF11841_low_8
Description: NF11841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11841_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 374; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 374; E-Value: 0
Query Start/End: Original strand, 8 - 393
Target Start/End: Complemental strand, 42985080 - 42984695
Alignment:
| Q |
8 |
agcagagaagatgaatttcaagccatctcggtttctccgattcgcaattcgaaatttatatgtttgttagtttgctttcccttctcttttagaggttgaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42985080 |
agcagagaagatgaatttcaagccatctcggtttcttcgattcgcaattcgaaatttatatgtttgttagtttgctttcccttctcttttagaggttgaa |
42984981 |
T |
 |
| Q |
108 |
gtttccatttcatgcactaaatttcatttacatagagaattttaatttaacaattacttatatgcagcaattaccatggtccttgcaattacatttcctt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42984980 |
gtttccatttcatgcactaaatttcatttacatagagaattttaatttaacaatttcttatatgcagcaattaccatggtccttgcaattacatttcctt |
42984881 |
T |
 |
| Q |
208 |
tctttggtgggcttctcagcttttttgggggatttgtatttgctccaaccacatattttgtaagaaaagtaaaatatcttgcatgtttagatcaatggtg |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42984880 |
tctttggtgggcttctcagcttttttgggggatttgtatttgctccaaccacatattttgtaagaaaagtaaaatatcttgcatgtttagatcaatggtg |
42984781 |
T |
 |
| Q |
308 |
agtttaacaaaatcacgtcggccctgtgattttgtgaagctaaaaaagcaaatgctgatgttaattatttttgtgatggtttgtag |
393 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42984780 |
agtttaacaaaatcacggcggccctgtgattttgtgaagctaaaaaagcaaatgctgatgttaattatttttgtgatggtttgtag |
42984695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 290 - 348
Target Start/End: Original strand, 10810894 - 10810952
Alignment:
| Q |
290 |
atgtttagatcaatggtgagtttaacaaaatcacgtcggccctgtgattttgtgaagct |
348 |
Q |
| |
|
|||||||||| || |||||||||| |||||||||| ||| ||||||||||||||||| |
|
|
| T |
10810894 |
atgtttagattaacggtgagtttagcaaaatcacgatggcattgtgattttgtgaagct |
10810952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University