View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11843_low_10 (Length: 241)
Name: NF11843_low_10
Description: NF11843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11843_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 23268415 - 23268645
Alignment:
| Q |
1 |
gcaacctgagtagtatttggcctagtacgttttttaagtttaataataggcacctctttcatctttccttttcctttttcattacttagcacttcttctc |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||||| |||| |||||||||||||||||||||||||||| |||||| || || |
|
|
| T |
23268415 |
gcaacctgagtagtatttggcctagcacgttttttaaatttaataataggcacatcttccatctttccttttcctttttcattacttggcactttttttc |
23268514 |
T |
|
| Q |
101 |
taccgtcagcattagcatttgtagccccctctcttataataagtggacctgccaccattggtattgtaggcatcatcctttctttcttcttagcgtatac |
200 |
Q |
| |
|
||| ||||||||||||||| |||||||||||||||||| |||||||||||||||||||||| ||| | |||||||| ||||||||||||||| ||||| |
|
|
| T |
23268515 |
tactgtcagcattagcattattagccccctctcttataacaagtggacctgccaccattggtcttgcaaccatcatccgttctttcttcttagcatatac |
23268614 |
T |
|
| Q |
201 |
cacacgccctgcatccgatgtttctcctatg |
231 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |
|
|
| T |
23268615 |
cacacgccctgcatcagatgtttctcctatg |
23268645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University