View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11843_low_11 (Length: 238)
Name: NF11843_low_11
Description: NF11843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11843_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 28462894 - 28463118
Alignment:
| Q |
1 |
caaaactcaaattaaaaatgttttacataagaatcaagcaaagtataagcttaatcaagataaacatgacatattagatttatccnnnnnnnnn-ttatt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
28462894 |
caaaactcaaattaaaaatgttttacataagaatcaagcaaagtataaacttaatcaagataaacaggacatattagatttatccaaaaaaaaaattatt |
28462993 |
T |
|
| Q |
100 |
tgagacaggagaatggatagcaaaattttggaaatgatcgtat--catcacatgaacaacttcacattttagatcagtgtgaagactaacagttaagaca |
197 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28462994 |
tgagacaagagaatgaatagcaaaattttggaaatgatcatatatcatcacatgaacaacttcacattttagatcagtgtgaagactaacagtttagaca |
28463093 |
T |
|
| Q |
198 |
tttttatgtt-caagtcttagatct |
221 |
Q |
| |
|
|||||||||| ||||||||| |||| |
|
|
| T |
28463094 |
tttttatgttccaagtcttatatct |
28463118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University