View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11843_low_3 (Length: 411)
Name: NF11843_low_3
Description: NF11843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11843_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 36 - 405
Target Start/End: Original strand, 23939213 - 23939582
Alignment:
| Q |
36 |
atctttttgtacttagttgaatacatagttttcccagtttcatccttcttcatcttgcttcgagtgactatgagactatacaacatattaaagttttcca |
135 |
Q |
| |
|
|||| |||||||||||| | || |||||||||||| |||||||||||||||| |||||||| |||||||||||||||| ||| ||||| | | ||||||| |
|
|
| T |
23939213 |
atctatttgtacttagtcgcatccatagttttcccggtttcatccttcttcaacttgcttccagtgactatgagactacacaccatatcacaattttcca |
23939312 |
T |
|
| Q |
136 |
tgacaaatcttgttagtatttcaccagtatatttgctttgaataatgaaaataccttgatcattcttcttaacttttccaagaaagtacctcatttttcc |
235 |
Q |
| |
|
|| |||||||||||||||||| |||| ||||||||||||| | |||||||||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
23939313 |
tgccaaatcttgttagtatttaaccaacatatttgctttgattgatgaaaataccttgatcattctgcttaacttctccaagaaagtacctcatttttcc |
23939412 |
T |
|
| Q |
236 |
taaagaatttgtctattgctatgattatgatgaaaatagctcttgacatctaattgatatacatcaatggaaacttcgtttgtctagttcttgactagag |
335 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23939413 |
taaataatttgtttattgctatgattatgatgaaaagcactcttgacatctaattgatatgcatcaatggaaacctcgtttgtctagttcttgactagag |
23939512 |
T |
|
| Q |
336 |
cactctagttccatcccttagtttgttcaaagatgtcatctctttttatcactgttttcttgcttttagt |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23939513 |
cactctagttccatcccttagtttgttcaaatatgtcatctctttttatcactgttttcttgcttttagt |
23939582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University