View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11843_low_5 (Length: 293)
Name: NF11843_low_5
Description: NF11843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11843_low_5 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 18 - 293
Target Start/End: Complemental strand, 23940763 - 23940488
Alignment:
| Q |
18 |
caacttttggcagcaaattcagttatgagttagttagattgatttgtttcttaaccaaccttcatctttcttctttgttcttccattgttcttctgcaac |
117 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23940763 |
caacttttggcggcaaattcagttatgagttagttagattgatttgtttcttaaccaaccttcatctttcttctttgttcttccattgttcttctgcaac |
23940664 |
T |
|
| Q |
118 |
tcattttccttcatccttgaccaagattgatcaactcccttgctcttttatatgcaagaatccacgaattacgtgcatccttctattccaaagttcgatg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23940663 |
tcattttccttcatccttgaccaagattgatcaactcccttgctcttttatatgcaagaatccacgaattacgtgcatccttctattccaaagtttgatg |
23940564 |
T |
|
| Q |
218 |
gcttttatgataattggactatgttgattgtaagtctgcttctctccaatgaatacaagagtttgattgagaattg |
293 |
Q |
| |
|
||||||||||| ||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23940563 |
gcttttatgatcattgggctatgttgattgaaagtctgcttctctccaatgaatacaagagtttgattgagaattg |
23940488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University