View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11843_low_8 (Length: 244)
Name: NF11843_low_8
Description: NF11843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11843_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 10 - 225
Target Start/End: Original strand, 51704799 - 51705014
Alignment:
| Q |
10 |
agcataggcgggtaaaaatgttgtgtcatttcatcttttgtgttttggtgtgtggatatatgcccatatttctaatatgatatggtctgtttcttttact |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
51704799 |
agcacaggcgggtaaaaatgttgtgtcatttcatcttttgtgttttggtgtgtggatatatgcccatatttctaatatgatatggtttgtttcttttact |
51704898 |
T |
|
| Q |
110 |
aatgattgttctcaagtaagttgannnnnnnnatttacaaaggataagtgataagtatctcgattgttcattcaattttagcatatgatacaagcacaac |
209 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51704899 |
aatgattgttctcaagtaagttgattttttttatttacaaaggataagtgataagtatctcgattgttcattcaattttagcatatgatacaagcacaac |
51704998 |
T |
|
| Q |
210 |
ttagaaaagtcattaa |
225 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
51704999 |
ttagaaaagtcattaa |
51705014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University