View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11843_low_9 (Length: 242)
Name: NF11843_low_9
Description: NF11843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11843_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 37212966 - 37213190
Alignment:
| Q |
1 |
ttaggagttattattaaatgtaaaaaatgcggattgtatctcttgataagttttgtgcgatccggagttacgatccaa--tatatcgaaaggacttacga |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||||||| |||||||||||||||||||||||||| |||||| ||||||||||||||||| || |
|
|
| T |
37212966 |
ttaggagttattattagatgtaaaaaatgcagattgtatctcttaataagttttgtgcgatccggagttacaatccaaaatatatcgaaaggacttatga |
37213065 |
T |
 |
| Q |
99 |
gcagaaggacttgtataacaatttgcttattgtaatatttatttatgtcatgttactttttgtcattttagaatacaaatggagtattagttacttttag |
198 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37213066 |
gcagaaggatttgtatagcaatttgcttattgtaatatttatttatgtcat--tactttttgtcattttagaatacaaatggagtattagttacttttac |
37213163 |
T |
 |
| Q |
199 |
accaatttccctatttattctcaacct |
225 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
37213164 |
accaatttccctatttattctcaacct |
37213190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University