View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11845_high_11 (Length: 228)
Name: NF11845_high_11
Description: NF11845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11845_high_11 |
 |  |
|
| [»] scaffold0027 (1 HSPs) |
 |  |  |
|
| [»] scaffold0021 (1 HSPs) |
 |  |  |
|
| [»] scaffold0180 (1 HSPs) |
 |  |  |
|
| [»] scaffold1694 (1 HSPs) |
 |  |  |
|
| [»] scaffold0143 (1 HSPs) |
 |  |  |
|
| [»] scaffold0735 (1 HSPs) |
 |  |  |
|
| [»] scaffold0040 (2 HSPs) |
 |  |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
| [»] scaffold0334 (1 HSPs) |
 |  |  |
|
| [»] scaffold0188 (1 HSPs) |
 |  |  |
|
| [»] scaffold0038 (1 HSPs) |
 |  |  |
|
| [»] scaffold0025 (1 HSPs) |
 |  |  |
|
| [»] scaffold0259 (1 HSPs) |
 |  |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |  |
|
| [»] scaffold0011 (2 HSPs) |
 |  |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
| [»] scaffold0350 (1 HSPs) |
 |  |  |
|
| [»] scaffold0238 (1 HSPs) |
 |  |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
| [»] scaffold0026 (1 HSPs) |
 |  |  |
|
| [»] scaffold0035 (1 HSPs) |
 |  |  |
|
| [»] scaffold1127 (1 HSPs) |
 |  |  |
|
| [»] scaffold0122 (1 HSPs) |
 |  |  |
|
| [»] scaffold0081 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |  |
|
| [»] scaffold0126 (1 HSPs) |
 |  |  |
|
| [»] scaffold0071 (1 HSPs) |
 |  |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
| [»] scaffold0118 (1 HSPs) |
 |  |  |
|
| [»] scaffold0087 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 149; Significance: 7e-79; HSPs: 75)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 10 - 214
Target Start/End: Original strand, 16204642 - 16204846
Alignment:
| Q |
10 |
tatccatggttcatagaagagtagtcatgaccaagtcaaatatttgttcatactaagttgatagaactctttctacaatgcaattaatttgctacttaga |
109 |
Q |
| |
|
||||| || ||||||||||| || |||| |||| ||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
16204642 |
tatccgtgcttcatagaagattattcatcaccatgtcaaatatttgtccatactaagttaatagaactctttctacaatgcaattaatttgctactttga |
16204741 |
T |
 |
| Q |
110 |
atgtgtgtggacatcactaatttgaagtctttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| ||| ||| |
|
|
| T |
16204742 |
atgtgtgtggacatcactaatttgaagtttttttattggtggtggtcgggatttgaaccccggaccttgcatacattatgcattgtccatatcaaccgag |
16204841 |
T |
 |
| Q |
210 |
ctaaa |
214 |
Q |
| |
|
||||| |
|
|
| T |
16204842 |
ctaaa |
16204846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 148 - 214
Target Start/End: Original strand, 24623307 - 24623373
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||||||||||||||||||||| | ||||| |||| |||||||||||||||||| |||||||||||| |
|
|
| T |
24623307 |
gtggtggtcggggtttgaaccccgaaccttacatatattatgcattgtccatatcaactgagctaaa |
24623373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 139 - 209
Target Start/End: Complemental strand, 13496196 - 13496126
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||| |||||| |||||||||||||||| | |||||||||||| |||||||||||| ||||| ||||||| |
|
|
| T |
13496196 |
ttttttttggtgttggtcggggtttgaactccggaccttgcatatattatgcattgttcatatcaactgag |
13496126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 151 - 213
Target Start/End: Complemental strand, 20744206 - 20744144
Alignment:
| Q |
151 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
20744206 |
gtggtcggggtttgaaccccagaccttgcatatattatgcattgtccataccaactgagctaa |
20744144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 148 - 213
Target Start/End: Original strand, 4455586 - 4455651
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||| ||||||||| ||||||||||| |
|
|
| T |
4455586 |
gtggtggtcggggtttgaaccccagaccttgcatatattatgccttgtccataccaactgagctaa |
4455651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 139 - 200
Target Start/End: Complemental strand, 8569789 - 8569728
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||| || ||||||| |||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
8569789 |
tttttttttgtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccata |
8569728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 139 - 212
Target Start/End: Original strand, 26489929 - 26490002
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagcta |
212 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||| ||||||| |||| |||||||| ||| |||||||||| |
|
|
| T |
26489929 |
ttttttttggtggtggttggggtttgaaccctggactttgcatattttatacattgtccctatcaactgagcta |
26490002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 136 - 200
Target Start/End: Original strand, 8629674 - 8629738
Alignment:
| Q |
136 |
gtctttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
|||||||| || |||||||||| ||||||||||| | |||||||||| ||||||||||||||||| |
|
|
| T |
8629674 |
gtctttttttttgtggtggtcgaggtttgaaccccgaaccttgcatatattatgcattgtccata |
8629738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 149 - 213
Target Start/End: Complemental strand, 33824951 - 33824887
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||| || ||||||||||| |||||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
33824951 |
tggtggccgaggtttgaaccccggaccttgcatatattatgcattgtccttatcaactgagctaa |
33824887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 655730 - 655804
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| ||||| |||| ||||||| |||||| |||||||||||| ||||||||||||| ||| ||||||||||| |
|
|
| T |
655730 |
ttttttttggtagtggccggggttcgaaccccggaccttgcatatattatgcattgtcgataccaactgagctaa |
655804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 12333549 - 12333623
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || ||| |||||||||||| ||| |||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
12333549 |
tttttttttgtgatggtcggggtttaaactctggaccttgcatattttatgcattgtccatactaactgagctaa |
12333623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 139 - 209
Target Start/End: Original strand, 34481395 - 34481465
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||| ||||| ||||||||||||||||||| |||||||||||| || ||||||||| |||| ||||||| |
|
|
| T |
34481395 |
ttttttttggttgtggtcggggtttgaaccccggaccttgcatatataatgcattgttcatactaactgag |
34481465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 148 - 213
Target Start/End: Complemental strand, 15187134 - 15187069
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||| | ||| | ||||||||| |
|
|
| T |
15187134 |
gtggtggtcggggtttgaacctcggaccttgcatatattatgcattgtacttatcagctgagctaa |
15187069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 148 - 213
Target Start/End: Original strand, 15473472 - 15473537
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||| | ||| | ||||||||| |
|
|
| T |
15473472 |
gtggtggtcggggtttgaacctcggaccttgcatatattatgcattgtacttatcagctgagctaa |
15473537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 148 - 213
Target Start/End: Complemental strand, 17935800 - 17935735
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||| |||||||||||||| | ||||||||||| |
|
|
| T |
17935800 |
gtggtggtcgggatttgaaccctagaccttgcatattttatgcattgtccaaaccaactgagctaa |
17935735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 148 - 213
Target Start/End: Complemental strand, 29740553 - 29740488
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||| |||||||||||||| ||||||||| || ||||||||||||||||| || |||||||| |
|
|
| T |
29740553 |
gtggtggccggggtttgaaccccggaccttgcgtatattatgcattgtccataccaattgagctaa |
29740488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 139 - 195
Target Start/End: Original strand, 18253320 - 18253376
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
||||| || ||||||| |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
18253320 |
tttttttttgtggtggatggggtttgaaccctggaccttgcatatattatgcattgt |
18253376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 32524411 - 32524459
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
32524411 |
tggtggttggggtttgaaccctggactttgcatatattatgcattgtcc |
32524459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 139 - 210
Target Start/End: Original strand, 28231406 - 28231477
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagc |
210 |
Q |
| |
|
||||| || ||||||| ||| || ||||||| |||||||||||| |||||||||||||| ||| |||||||| |
|
|
| T |
28231406 |
tttttttttgtggtggccggagtgtgaaccccggaccttgcatatattatgcattgtccctatcaactgagc |
28231477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 145 - 195
Target Start/End: Original strand, 12323477 - 12323527
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||| ||| |||||||||||| |
|
|
| T |
12323477 |
ttggtggtggtcggtgtttgaaccctgaaccttgtatatattatgcattgt |
12323527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 151 - 213
Target Start/End: Original strand, 14918293 - 14918355
Alignment:
| Q |
151 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||||||||||| ||||||| ||| |||||||||||||| || ||||||||||| |
|
|
| T |
14918293 |
gtggtcggggtttgaaccccagaccttgtatatattatgcattgtccctaccaactgagctaa |
14918355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 151 - 213
Target Start/End: Complemental strand, 24827120 - 24827058
Alignment:
| Q |
151 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||||| |||||||| ||||| ||| ||||||||||||||||| ||||||||||| |
|
|
| T |
24827120 |
gtggtcggggttcgaaccctgaaccttatatattttatgcattgtccatatcaactgagctaa |
24827058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 32053868 - 32053794
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| ||| |||||| ||| ||||||||| | |||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
32053868 |
ttttttttgttggtggccggagtttgaaccacgaaccttgcatatattatgcattgtccataccaactgagctaa |
32053794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 148 - 197
Target Start/End: Complemental strand, 788937 - 788888
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
|||||||||||||||||||| | | |||||||||| |||||||||||||| |
|
|
| T |
788937 |
gtggtggtcggggtttgaactccgaaccttgcatatattatgcattgtcc |
788888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 145 - 209
Target Start/End: Complemental strand, 2546254 - 2546187
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacatt---atgcattgtccatataaactgag |
209 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||| ||| |||||||||||||| || ||||| |
|
|
| T |
2546254 |
ttggtggtggtcggggtttgaaccccgtaccttgcatatattatgatgcattgtccatacaatctgag |
2546187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 156 - 209
Target Start/End: Original strand, 2726415 - 2726468
Alignment:
| Q |
156 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||||| |||||| |||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
2726415 |
cggggttcgaaccccggaccttgcatatattatgcattgtccataccaactgag |
2726468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 139 - 196
Target Start/End: Complemental strand, 29283895 - 29283838
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
196 |
Q |
| |
|
||||| || ||||||||||| ||||||||||| ||||||||||| ||||| ||||||| |
|
|
| T |
29283895 |
tttttttttgtggtggtcggagtttgaaccctagaccttgcatatattatacattgtc |
29283838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 145 - 209
Target Start/End: Complemental strand, 2445373 - 2445309
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
|||||||||||||||||| |||||| | | |||| ||| |||||||||||| ||||| ||||||| |
|
|
| T |
2445373 |
ttggtggtggtcggggttcgaaccccgaatcttgtatatattatgcattgttcatatcaactgag |
2445309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 148 - 200
Target Start/End: Complemental strand, 9977128 - 9977076
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||| |||||||||| |||||| |
|
|
| T |
9977128 |
gtggtggtcagggtttgaaccccagaccttgcatatattatgcattatccata |
9977076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 145 - 213
Target Start/End: Original strand, 12700408 - 12700476
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| ||||||| |||||| ||||||||||| |||||||||||| |||| |||||| |||| |
|
|
| T |
12700408 |
ttggtggtggccggggttcaaaccctagaccttgcatatattatgcattgttcataccaactgaactaa |
12700476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 145 - 213
Target Start/End: Complemental strand, 14610054 - 14609987
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||| |||| ||||| ||||||| ||| ||||||||||| |
|
|
| T |
14610054 |
ttggtggtggccggggtttgaaccc-ggaccttacatatattatagattgtccctatcaactgagctaa |
14609987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 18256940 - 18256889
Alignment:
| Q |
161 |
tttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
18256940 |
tttgaaccc-ggaccttgcatatattatgcattgtccttatcaactgagctaa |
18256889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 145 - 213
Target Start/End: Original strand, 20847499 - 20847566
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||| | ||||||||||| |||||||||||| |||||||||||||| | ||||||||||| |
|
|
| T |
20847499 |
ttggtggtggttgaggtttgaaccc-ggaccttgcatattttatgcattgtccaaactaactgagctaa |
20847566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 145 - 213
Target Start/End: Original strand, 22792927 - 22792995
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||| |||| ||||| | |||||| || ||||||||||| |
|
|
| T |
22792927 |
ttggtcgtggtcggggtttgaaccccggaccttacatatattattcgttgtccttaccaactgagctaa |
22792995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 145 - 213
Target Start/End: Original strand, 27907938 - 27908006
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| ||||||||| ||| | | ||||||||||| |
|
|
| T |
27907938 |
ttggtggtggccggggtttgaaccccagaccttgcatattttatgcattatccttgtcaactgagctaa |
27908006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 137 - 197
Target Start/End: Complemental strand, 33976326 - 33976266
Alignment:
| Q |
137 |
tctttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||||| || ||| ||| |||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
33976326 |
tctttttttttgtgatggccggggtttgaaccccggaccttgcatattttatgcattgtcc |
33976266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 139 - 214
Target Start/End: Original strand, 866266 - 866341
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||| || ||| ||||||||||||||||| || |||||||||| ||||||||| || | || |||||||||||| |
|
|
| T |
866266 |
tttttttttgtgatggtcggggtttgaaccatgaaccttgcatatattatgcatcgtgcctaccaactgagctaaa |
866341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 139 - 214
Target Start/End: Original strand, 8138439 - 8138514
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||| || |||||||| | ||||||||||| |||||| |||| |||||||||||| | ||| |||||||||||| |
|
|
| T |
8138439 |
tttttttttgtggtggttgaggtttgaaccccagaccttacatatattatgcattgttcttatcaactgagctaaa |
8138514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 139 - 198
Target Start/End: Original strand, 8393733 - 8393792
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcca |
198 |
Q |
| |
|
||||| ||||| |||| ||||||||||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
8393733 |
ttttttttggtagtggccggggtttgaaacctggaccttgcatattttatgcattatcca |
8393792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 139 - 198
Target Start/End: Complemental strand, 9367481 - 9367422
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcca |
198 |
Q |
| |
|
||||| || ||||||||||||||||||| || ||||||||||| |||||||||||||| |
|
|
| T |
9367481 |
tttttttttgtggtggtcggggtttgaatcccagaccttgcatattttatgcattgtcca |
9367422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 158 - 213
Target Start/End: Original strand, 14441455 - 14441510
Alignment:
| Q |
158 |
gggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||| || | ||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
14441455 |
gggtttgaagcccgaaccttgcatacattatgcattgtccttaccaactgagctaa |
14441510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 148 - 195
Target Start/End: Complemental strand, 15155806 - 15155759
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
15155806 |
gtggtggtcgtggtttgaaccccagaccttgcatatattatgcattgt |
15155759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 148 - 195
Target Start/End: Complemental strand, 15170002 - 15169955
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
|||||||||||||||||||||| | ||||| |||| |||||||||||| |
|
|
| T |
15170002 |
gtggtggtcggggtttgaaccccgaaccttacatatattatgcattgt |
15169955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 148 - 195
Target Start/End: Complemental strand, 15178774 - 15178727
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
|||||||||||||||||||||| | ||||| |||| |||||||||||| |
|
|
| T |
15178774 |
gtggtggtcggggtttgaaccccgaaccttacatatattatgcattgt |
15178727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 197
Target Start/End: Complemental strand, 247739 - 247681
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || ||||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
247739 |
tttttttttgtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
247681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 138 - 212
Target Start/End: Complemental strand, 8639127 - 8639053
Alignment:
| Q |
138 |
ctttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagcta |
212 |
Q |
| |
|
|||||| || ||||| | ||| |||||||||| |||||||||||| | |||||||| |||||| |||||||||| |
|
|
| T |
8639127 |
ctttttttttgtggtagccggtgtttgaaccccggaccttgcatatactatgcattatccataccaactgagcta |
8639053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 213
Target Start/End: Complemental strand, 9111111 - 9111053
Alignment:
| Q |
155 |
tcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||| |||||| |||||||||||| |||||||||||| |||| |||||| |||| |
|
|
| T |
9111111 |
tcggggttcgaaccccggaccttgcatatattatgcattgttcataccaactgaactaa |
9111053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 9445037 - 9444963
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || |||||||||||| || |||||||| |||||||||| |||| |||||| |||| ||||||||||| |
|
|
| T |
9445037 |
tttttttttgtggtggtcgggattcgaaccctgaaccttgcatattttatacattgttcataccaactgagctaa |
9444963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 13376392 - 13376318
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| |||||||||| | ||||| |||||| ||||| ||||| ||||||||||||||||| || |||||||| |
|
|
| T |
13376392 |
ttttttttggtggtggccagggttagaaccccggaccatgcatgtattatgcattgtccataccaattgagctaa |
13376318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 14296938 - 14297012
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || ||||||| |||||||||||||| ||||||| |||| ||||| |||||||||| |||| |||||| |
|
|
| T |
14296938 |
tttttttttgtggtggccggggtttgaaccccggaccttacatattttatgtattgtccataccaactcagctaa |
14297012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 21847274 - 21847200
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| |||||||||| |||| || |||||| | |||||||||| |||||| ||||||| || ||||||||||| |
|
|
| T |
21847274 |
ttttttttggtggtggccgggattcgaaccccgtaccttgcatatattatgtattgtccctaccaactgagctaa |
21847200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 26320545 - 26320618
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || |||||| ||| |||||||||| |||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
26320545 |
ttttttttagtggtgaccggagtttgaaccc-ggaccttgcatattttatgcattgtccataccaactgagctaa |
26320618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 145 - 195
Target Start/End: Original strand, 28758277 - 28758327
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
||||||||| |||||||||||||| |||| ||||||| |||||||||||| |
|
|
| T |
28758277 |
ttggtggtgttcggggtttgaacctcggactttgcatatattatgcattgt |
28758327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 213
Target Start/End: Original strand, 30960054 - 30960108
Alignment:
| Q |
159 |
ggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||| ||||||||| || ||||||||||| |
|
|
| T |
30960054 |
ggttcgaaccctggaccttgcatatattaagcattgtccttaccaactgagctaa |
30960108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 195
Target Start/End: Complemental strand, 34474297 - 34474251
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
|||||| ||||||| ||||| ||||||||||||| |||||||||||| |
|
|
| T |
34474297 |
tggtggccggggttcgaaccatggaccttgcatatattatgcattgt |
34474251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 145 - 198
Target Start/End: Complemental strand, 4257675 - 4257622
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcca |
198 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
4257675 |
ttggtggtggccggggtttgaaccccagaccttgcataagatatgcattgtcca |
4257622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 164 - 213
Target Start/End: Complemental strand, 4450317 - 4450268
Alignment:
| Q |
164 |
gaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||| ||| ||||||||||| |
|
|
| T |
4450317 |
gaaccccggaccttgcatatattatgcattgtctttatcaactgagctaa |
4450268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 140 - 213
Target Start/End: Original strand, 9372338 - 9372410
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||| ||||||| || |||||||||||||| | || ||||||| ||||||| ||||||||| ||||||||||| |
|
|
| T |
9372338 |
tttttttggtgggggccggggtttgaaccccgaac-ttgcatatattatgcgttgtccatactaactgagctaa |
9372410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 139 - 200
Target Start/End: Original strand, 11456357 - 11456417
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||| || ||||||| |||||||||||||| | ||||| |||| ||||||||||||||||| |
|
|
| T |
11456357 |
tttttttttgtggtggccggggtttgaaccccg-accttacatatattatgcattgtccata |
11456417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 148 - 209
Target Start/End: Original strand, 12232172 - 12232233
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||||||||||||| |||||| ||| |||||| |||||||||||||| ||| ||||||| |
|
|
| T |
12232172 |
gtggtggtcggggttcgaaccccagacactgcatatattatgcattgtccctatcaactgag |
12232233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 167 - 200
Target Start/End: Complemental strand, 17145533 - 17145500
Alignment:
| Q |
167 |
ccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
17145533 |
ccctggaccttgcatatattatgcattgtccata |
17145500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 139 - 196
Target Start/End: Original strand, 24373691 - 24373748
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
196 |
Q |
| |
|
||||| || ||||||| ||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
24373691 |
tttttttttgtggtggctggggtttgaacccctgaccttgcatatattatgcattgtc |
24373748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 138 - 211
Target Start/End: Original strand, 26303790 - 26303863
Alignment:
| Q |
138 |
ctttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagct |
211 |
Q |
| |
|
||||||||||||||||||||| ||||||||| || |||| ||| |||||| ||||||| ||| ||| ||||| |
|
|
| T |
26303790 |
ctttttattggtggtggtcggcgtttgaaccactgatcttgtatatattatgtattgtccttatcaaccgagct |
26303863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 139 - 196
Target Start/End: Original strand, 27080679 - 27080736
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
196 |
Q |
| |
|
||||| || ||||||||||||||||||| || || |||||||| ||||||||||||| |
|
|
| T |
27080679 |
tttttttttgtggtggtcggggtttgaatcccagagcttgcatatattatgcattgtc |
27080736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 148 - 197
Target Start/End: Complemental strand, 27834410 - 27834361
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||| ||||||| |||||| |
|
|
| T |
27834410 |
gtggtggtccgggtttgaaccccagaccttgcatatattatgccttgtcc |
27834361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 212
Target Start/End: Complemental strand, 2613563 - 2613499
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagcta |
212 |
Q |
| |
|
|||||| |||||||| ||||| | ||||||||||| |||| |||||||||| | |||||||||| |
|
|
| T |
2613563 |
gtggtgatcggggttcgaaccttagaccttgcatatattaagcattgtccaaaccaactgagcta |
2613499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 200
Target Start/End: Complemental strand, 4855627 - 4855575
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||||||||||||||||| |||| | ||| |||| |||||||||||||||| |
|
|
| T |
4855627 |
gtggtggtcggggtttgaatcctgaatcttacatattttatgcattgtccata |
4855575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 139 - 195
Target Start/End: Complemental strand, 8809386 - 8809330
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
||||| || ||| ||||||||||||||||| ||| |||||||| |||||||||||| |
|
|
| T |
8809386 |
tttttttttgtgatggtcggggtttgaacctcggatcttgcatatattatgcattgt |
8809330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 196
Target Start/End: Original strand, 8840510 - 8840558
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
196 |
Q |
| |
|
||||||||| |||||||||||||| || || |||| ||||||||||||| |
|
|
| T |
8840510 |
gtggtggtccgggtttgaaccctgtactttacatatattatgcattgtc |
8840558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 213
Target Start/End: Original strand, 9392659 - 9392723
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||| |||||||||| |||| |||||||||||| |||||||||| | |||| ||||||||||| |
|
|
| T |
9392659 |
tggtagtcggggtttaaacctcggaccttgcatatattatgcatttttcataacaactgagctaa |
9392723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 12318825 - 12318773
Alignment:
| Q |
161 |
tttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||| |||| |||||| |||| |
|
|
| T |
12318825 |
tttgaaccctagaccttgcatacattatgtattgttcatagcaactgaactaa |
12318773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 16390499 - 16390451
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
|||||| || ||||||||||| ||||||| |||| |||||||||||||| |
|
|
| T |
16390499 |
tggtggccgaggtttgaaccccggaccttacatatattatgcattgtcc |
16390451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 213
Target Start/End: Complemental strand, 26400934 - 26400870
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||| ||||||| ||||| |||||||||||| |||||| |||||||||| || |||||||| |
|
|
| T |
26400934 |
tggtggccggggttcaaaccccggaccttgcatatattatgtattgtccataccaattgagctaa |
26400870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 192
Target Start/End: Complemental strand, 32621443 - 32621399
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcat |
192 |
Q |
| |
|
||||||||||||||||||| || ||||||| |||| ||||||||| |
|
|
| T |
32621443 |
gtggtggtcggggtttgaatcccggaccttacatatattatgcat |
32621399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 33542798 - 33542846
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
|||||||||| |||||||| || |||||||||| |||||||||||||| |
|
|
| T |
33542798 |
tggtggtcggagtttgaactatgaaccttgcatatattatgcattgtcc |
33542846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 51; Significance: 2e-20; HSPs: 99)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 19163517 - 19163591
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || |||||||||||||||||||||| |||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
19163517 |
tttttttttgtggtggtcggggtttgaaccccggaccttgcataaattatgcattgtccataccaactgagctaa |
19163591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 139 - 200
Target Start/End: Complemental strand, 12748981 - 12748920
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||| |||||||||| |||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
12748981 |
ttttttttggtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccata |
12748920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 139 - 200
Target Start/End: Original strand, 26932744 - 26932805
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
26932744 |
ttttttttggtggtggtcgtggtttgaaccctggaccttgcatatatcatgcattgtccata |
26932805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 149 - 213
Target Start/End: Original strand, 27718885 - 27718949
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| |||||||| | |||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
27718885 |
tggtggtcggagtttgaactccggaccttgcatatattatgcattgtccatatcaactgagctaa |
27718949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 145 - 213
Target Start/End: Original strand, 32051519 - 32051587
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||| ||||||||||||||| | ||||||||||| |
|
|
| T |
32051519 |
ttggtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccaaaccaactgagctaa |
32051587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 145 - 200
Target Start/End: Original strand, 12800887 - 12800942
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |||||| |||||||||| |
|
|
| T |
12800887 |
ttggtggtggtcggggtttgaaccccggaccttgcatatattatgtattgtccata |
12800942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 148 - 213
Target Start/End: Complemental strand, 7997011 - 7996946
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||| ||||||||| ||||||||||| |
|
|
| T |
7997011 |
gtggtggtcggggtttgaaccccagaccttgcatatattatgcgttgtccataccaactgagctaa |
7996946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 148 - 197
Target Start/End: Complemental strand, 8881346 - 8881297
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8881346 |
gtggtggccggggtttgaaccctggaccttgcatatattatgcattgtcc |
8881297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 145 - 214
Target Start/End: Original strand, 19260566 - 19260635
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||| |||| |||||||||||| ||||| |||| ||||||| |
|
|
| T |
19260566 |
ttggtggtggccggggtttgaaccccggaccttacatatattatgcattgtacatatcaactaagctaaa |
19260635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 149 - 214
Target Start/End: Complemental strand, 29652288 - 29652223
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||| |||||||||||| | ||| |||||||||||| |
|
|
| T |
29652288 |
tggtggtcgaggtttgaactctggaccttgcatatattatgcattgttcttatcaactgagctaaa |
29652223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 145 - 213
Target Start/End: Complemental strand, 27587295 - 27587227
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||| || ||||||||||| || ||||||||||| |
|
|
| T |
27587295 |
ttggtggtggccggggtttgaaccccggaccttgcatatatcatgcattgtccttaccaactgagctaa |
27587227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 140 - 198
Target Start/End: Complemental strand, 22775707 - 22775649
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcca |
198 |
Q |
| |
|
|||| |||||||||| | |||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
22775707 |
tttttttggtggtggccagggtttgaaccccggaccttgcataaattatgcattgtcca |
22775649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 24023689 - 24023763
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || |||||||||||||||||||||| |||||||||| ||||||| |||| |||||| |||||| |||| |
|
|
| T |
24023689 |
tttttttttgtggtggtcggggtttgaaccccggaccttgcagacattatacattatccataccaactgacctaa |
24023763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 156 - 214
Target Start/End: Original strand, 33482147 - 33482205
Alignment:
| Q |
156 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||| ||| |||| ||||||| |
|
|
| T |
33482147 |
cgggatttgaaccctggaccttgcataaattatgcattgtccctatcaactaagctaaa |
33482205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 149 - 214
Target Start/End: Original strand, 8717466 - 8717531
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||||| || ||||||||||| | |||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
8717466 |
tggtggccgaggtttgaaccccgaaccttgcatatattatgcattgtccataccaactgagctaaa |
8717531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 148 - 193
Target Start/End: Original strand, 8999881 - 8999926
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcatt |
193 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
8999881 |
gtggtggtcggggtttgaaccctggactttgcatatattatgcatt |
8999926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 159 - 200
Target Start/End: Original strand, 10871895 - 10871936
Alignment:
| Q |
159 |
ggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10871895 |
ggtttgaaccccggaccttgcatacattatgcattgtccata |
10871936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 140 - 213
Target Start/End: Complemental strand, 29499850 - 29499777
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||| ||||||||| | |||||| ||||||||||||||||||| |||||||||||||||| || |||||||| |
|
|
| T |
29499850 |
tttttttggtggtgtttggggttcgaaccctggaccttgcatattttatgcattgtccataccaattgagctaa |
29499777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 149 - 213
Target Start/End: Complemental strand, 11709056 - 11708992
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
11709056 |
tggtggtcggggtttgaacttcggaccttgcatatattatgcattgtccctaccaactgagctaa |
11708992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 149 - 201
Target Start/End: Complemental strand, 23159511 - 23159459
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatat |
201 |
Q |
| |
|
||||||||||||||||||||| | | |||||||| |||||||||||||||||| |
|
|
| T |
23159511 |
tggtggtcggggtttgaaccccgaatcttgcatatattatgcattgtccatat |
23159459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 145 - 197
Target Start/End: Original strand, 24838157 - 24838209
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
24838157 |
ttggtggtggccggggtttgaaccccggaccttgcatattttatgcattgtcc |
24838209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 139 - 214
Target Start/End: Original strand, 6235532 - 6235607
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||| || ||||||| ||||||||||| || ||||||| |||| ||||||||| ||||||| |||||||||||| |
|
|
| T |
6235532 |
tttttttttgtggtggccggggtttgaatcccggaccttacatatattatgcatcgtccataccaactgagctaaa |
6235607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 148 - 199
Target Start/End: Original strand, 9478025 - 9478076
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccat |
199 |
Q |
| |
|
||||||||| |||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
9478025 |
gtggtggtcagggtttgatccccagaccttgcatacattatgcattgtccat |
9478076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 139 - 198
Target Start/End: Original strand, 14598179 - 14598238
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcca |
198 |
Q |
| |
|
||||| || |||||||||||||||||||||| | ||||||| || ||||||||||||||| |
|
|
| T |
14598179 |
tttttttttgtggtggtcggggtttgaaccccgcaccttgcttatattatgcattgtcca |
14598238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 145 - 196
Target Start/End: Original strand, 15001262 - 15001313
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
196 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
15001262 |
ttggtggtggccggggtttgaaccttggaccttgcatattttatgcattgtc |
15001313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 150 - 213
Target Start/End: Complemental strand, 24195318 - 24195255
Alignment:
| Q |
150 |
ggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||| |||| |||||||||| |||||||||||| |||||| ||||| ||||| ||||||||||| |
|
|
| T |
24195318 |
ggtgatcggagtttgaaccccggaccttgcatatattatgtattgttcatatcaactgagctaa |
24195255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 197
Target Start/End: Complemental strand, 444493 - 444435
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || ||||||| |||||||| ||||| |||||||||||| |||||||||||||| |
|
|
| T |
444493 |
tttttttttgtggtggccggggtttaaaccccggaccttgcatatattatgcattgtcc |
444435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 151 - 209
Target Start/End: Complemental strand, 11053044 - 11052986
Alignment:
| Q |
151 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
|||||||||||| ||||| |||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
11053044 |
gtggtcggggttcaaaccccggaccttgcatatattatgcattgtccatactaactgag |
11052986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 152 - 214
Target Start/End: Complemental strand, 14303232 - 14303170
Alignment:
| Q |
152 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||||||||| ||||| ||||||||| ||| ||||| ||||||||||| |||||||||||| |
|
|
| T |
14303232 |
tggtcggggttcgaaccttggaccttgtatatattatacattgtccataccaactgagctaaa |
14303170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 145 - 195
Target Start/End: Original strand, 24023402 - 24023452
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
24023402 |
ttggtagtggtcggggtttgaaccccggaccttgcatattttatgcattgt |
24023452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 209
Target Start/End: Complemental strand, 29376981 - 29376911
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||| || |||||||||||||||||||| | ||||||||||| |||| |||||||||||| ||||||| |
|
|
| T |
29376981 |
tttttttttgtggtggtcggggtttgaactccagaccttgcatatattacgcattgtccataccaactgag |
29376911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 159 - 213
Target Start/End: Complemental strand, 30427790 - 30427737
Alignment:
| Q |
159 |
ggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
30427790 |
ggtttgaacc-tggaccttgcatatattatgcattgtccataccaactgagctaa |
30427737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 209
Target Start/End: Original strand, 32944821 - 32944891
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||| || ||||||||||||||||||||| ||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
32944821 |
tttttttttgtggtggtcggggtttgaacctcagaccttgcatattttatgcattgtccataccaactgag |
32944891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 140 - 213
Target Start/End: Original strand, 36059343 - 36059417
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacatt-atgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||| ||||||||| ||||||| ||||||| ||||||||||| ||| |||||||||| |||| ||||||||||| |
|
|
| T |
36059343 |
tttttttggtggtgtccggggttcgaaccctcgaccttgcatatattgatgcattgtctatatcaactgagctaa |
36059417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 140 - 214
Target Start/End: Original strand, 37749981 - 37750055
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||| ||| |||||| ||||||| ||||| |||| ||||||| |||||||||||| ||||| |||||||||||| |
|
|
| T |
37749981 |
tttttttgatggtggccggggttcaaaccccggactttgcatatattatgcattgttcatatcaactgagctaaa |
37750055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 148 - 213
Target Start/End: Original strand, 6038265 - 6038330
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||| ||| |||||||| | |||||| |||| |||||||||||||||||| ||||||||||| |
|
|
| T |
6038265 |
gtggtggccggagtttgaactccagaccttacatatattatgcattgtccatatcaactgagctaa |
6038330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 140 - 213
Target Start/End: Original strand, 8461818 - 8461891
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||| ||||| ||||||||||||||||| | |||||||||||| ||||||||||||| | ||||||||||| |
|
|
| T |
8461818 |
tttttttggtagtggtcggggtttgaactccggaccttgcatattttatgcattgtcccaaccaactgagctaa |
8461891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 160 - 197
Target Start/End: Original strand, 12160431 - 12160468
Alignment:
| Q |
160 |
gtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12160431 |
gtttgaaccctggaccttgcatacattatgcagtgtcc |
12160468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 148 - 213
Target Start/End: Original strand, 26773792 - 26773857
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||| ||||| |||||||||| ||||||||||| ||||||||| |||| ||| |||| |||||| |
|
|
| T |
26773792 |
gtggtgatcgggatttgaaccctagaccttgcatatattatgcatcgtccttattaactaagctaa |
26773857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 149 - 210
Target Start/End: Original strand, 26991748 - 26991809
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagc |
210 |
Q |
| |
|
||||||||| |||||||||| |||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
26991748 |
tggtggtcgtggtttgaaccacaaaccttgcatatattatgcattgtccatatcaactgagc |
26991809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 139 - 192
Target Start/End: Original strand, 30176400 - 30176453
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcat |
192 |
Q |
| |
|
||||| ||||||||| |||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
30176400 |
ttttttttggtggtgtccggggtttgaaccccggaccttgcatatattatgcat |
30176453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 139 - 208
Target Start/End: Complemental strand, 30218283 - 30218214
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactga |
208 |
Q |
| |
|
||||| |||||||| |||||||||| ||| | |||| ||||||| |||||||||||| ||||| |||||| |
|
|
| T |
30218283 |
ttttttttggtggttgtcggggtttaaactccggacattgcatatattatgcattgttcatatcaactga |
30218214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 140 - 213
Target Start/End: Complemental strand, 30623372 - 30623299
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||| ||||| ||| |||||||| |||||| ||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
30623372 |
tttttttggtcgtgttcggggttcgaaccccagaccttgcatatattatgcattgtccttaccaactgagctaa |
30623299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 154 - 195
Target Start/End: Original strand, 31336803 - 31336844
Alignment:
| Q |
154 |
gtcggggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
31336803 |
gtcggggtttgaaccctagaccttgcatatattatgcattgt |
31336844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 151 - 203
Target Start/End: Original strand, 34645078 - 34645131
Alignment:
| Q |
151 |
gtggtcggggtttgaaccctggaccttgcata-cattatgcattgtccatataa |
203 |
Q |
| |
|
|||||||||||| |||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
34645078 |
gtggtcggggttcgaaccccggaccttgcatattattatgcattgtccatataa |
34645131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 139 - 200
Target Start/End: Complemental strand, 37141437 - 37141376
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||| || ||||||| ||| |||||||||| | |||||||||| ||||||||||||||||| |
|
|
| T |
37141437 |
ttttttttcgtggtggccggagtttgaaccccgaaccttgcatatattatgcattgtccata |
37141376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 140 - 200
Target Start/End: Complemental strand, 7718779 - 7718719
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
|||| ||||||||| ||| ||| ||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
7718779 |
tttttttggtggtgttcgaagttcgaaccttggaccttgcatatattatgcattgtccata |
7718719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 145 - 209
Target Start/End: Original strand, 13357428 - 13357492
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
|||||||||| || |||||||||| | |||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
13357428 |
ttggtggtggccgaggtttgaacctcgtaccttgcatatattatgcattgtccataccaactgag |
13357492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 140 - 200
Target Start/End: Complemental strand, 15020840 - 15020780
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
|||| |||||||||| | |||||||||||| ||| |||||||| ||||| ||||||||||| |
|
|
| T |
15020840 |
tttttttggtggtggccagggtttgaaccccggatcttgcatatattatacattgtccata |
15020780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 140 - 212
Target Start/End: Original strand, 25136826 - 25136898
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagcta |
212 |
Q |
| |
|
|||| |||||||||| || |||||||||| |||||||||||| |||||| ||||||||| |||||||||| |
|
|
| T |
25136826 |
tttttttggtggtggccgaggtttgaacctcggaccttgcatattttatgccttgtccataccaactgagcta |
25136898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 140 - 196
Target Start/End: Complemental strand, 39076599 - 39076543
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
196 |
Q |
| |
|
|||||||||||||| || ||||| |||||| |||||||||||| |||||||||||| |
|
|
| T |
39076599 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtc |
39076543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 140 - 196
Target Start/End: Complemental strand, 39077085 - 39077029
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
196 |
Q |
| |
|
|||||||||||||| || ||||| |||||| |||||||||||| |||||||||||| |
|
|
| T |
39077085 |
ttttattggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgtc |
39077029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 139 - 214
Target Start/End: Complemental strand, 7553759 - 7553684
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||| || |||||| ||| ||||||||| ||||||||||||| |||||||||||||| || ||||||| |||| |
|
|
| T |
7553759 |
tttttttttgtggtgtccggagtttgaaccttggaccttgcatatattatgcattgtccctaccaactgagttaaa |
7553684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 137 - 200
Target Start/End: Original strand, 13124342 - 13124405
Alignment:
| Q |
137 |
tctttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||||| || ||| ||| |||||||||||||| |||||||||||| ||||||||||| |||| |
|
|
| T |
13124342 |
tctttttttttgtgatggccggggtttgaaccccggaccttgcatattttatgcattgttcata |
13124405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 150 - 213
Target Start/End: Complemental strand, 13286199 - 13286137
Alignment:
| Q |
150 |
ggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||| ||||||||||||| ||| ||||||||||| |
|
|
| T |
13286199 |
ggtggccggggtttgaaccc-ggatcttgcatatattatgcattgtctataccaactgagctaa |
13286137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 148 - 195
Target Start/End: Complemental strand, 18533740 - 18533693
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
|||||||| ||||||||||||| ||| |||||||| |||||||||||| |
|
|
| T |
18533740 |
gtggtggttggggtttgaaccccggatcttgcatatattatgcattgt |
18533693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 145 - 212
Target Start/End: Complemental strand, 29908085 - 29908018
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagcta |
212 |
Q |
| |
|
|||||||||||| | ||| ||| |||||||||||||| |||||||||||||| || |||||||||| |
|
|
| T |
29908085 |
ttggtggtggtcagattttaaactctggaccttgcatatattatgcattgtccctaccaactgagcta |
29908018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 159 - 214
Target Start/End: Original strand, 32115407 - 32115462
Alignment:
| Q |
159 |
ggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||||||||| | ||||| |||| |||||||||||||||||| |||||| ||||| |
|
|
| T |
32115407 |
ggtttgaaccccgaaccttacatatattatgcattgtccatattaactgaactaaa |
32115462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 213
Target Start/End: Complemental strand, 32192959 - 32192900
Alignment:
| Q |
154 |
gtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||| |||||| | |||||||||| ||||||||||||||||| |||| |||||| |
|
|
| T |
32192959 |
gtcggggttcgaaccccgaaccttgcatatattatgcattgtccataccaactaagctaa |
32192900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 140 - 195
Target Start/End: Complemental strand, 33105470 - 33105415
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
|||| ||||||| || ||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
33105470 |
tttttttggtggaggctggggtttgaaccccggaccttgcatatattatgcattgt |
33105415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 158 - 213
Target Start/End: Complemental strand, 39821945 - 39821890
Alignment:
| Q |
158 |
gggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
39821945 |
gggtttgaaccccagaccttgcatatattatgcattgtccctaccaactgagctaa |
39821890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 159 - 214
Target Start/End: Original strand, 42208470 - 42208525
Alignment:
| Q |
159 |
ggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
42208470 |
ggtttgaacctcggaccttgcatatattatgcattgtccttaccaactgagctaaa |
42208525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 139 - 214
Target Start/End: Complemental strand, 43778099 - 43778024
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||| |||||||||||||| ||||||||| ||||||||||| |||||||||||| ||| ||||||| |||| |
|
|
| T |
43778099 |
ttttttttggtggtggtcggagtttgaacctcagaccttgcatattttatgcattgtctataccaactgagttaaa |
43778024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 145 - 195
Target Start/End: Complemental strand, 6471585 - 6471535
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
|||||||||| |||||||||||||| | || ||||||| |||||||||||| |
|
|
| T |
6471585 |
ttggtggtggccggggtttgaaccccgaacattgcatatattatgcattgt |
6471535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 197
Target Start/End: Original strand, 20665344 - 20665402
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || ||||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
20665344 |
tttttttttgtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
20665402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 197
Target Start/End: Original strand, 21061789 - 21061855
Alignment:
| Q |
131 |
ttgaagtctttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
|||| |||||||| || ||||||| ||||||||||||| | ||||||||| |||||||||||||| |
|
|
| T |
21061789 |
ttgacgtctttttttttgtggtggctggggtttgaaccccgaaccttgcatgtattatgcattgtcc |
21061855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 23852991 - 23852917
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| |||||||||| |||| || |||| |||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
23852991 |
ttttttttggtggtgggcgggattcaaaccacggaccttgcatatattatgcattgtccataccgactgagctaa |
23852917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 209
Target Start/End: Original strand, 24695999 - 24696057
Alignment:
| Q |
151 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
|||||| ||||||||| | ||| |||||||| |||||||||||||||||| ||||||| |
|
|
| T |
24695999 |
gtggtcagggtttgaatctcggatcttgcatatattatgcattgtccatatcaactgag |
24696057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 135 - 213
Target Start/End: Original strand, 27750881 - 27750959
Alignment:
| Q |
135 |
agtctttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||| || || ||| ||| |||| |||||| |||||||||||| |||||||| ||||| || ||||||||||| |
|
|
| T |
27750881 |
agtctttttttttgtagtgttcgaggttcgaaccccggaccttgcatatattatgcactgtccttaccaactgagctaa |
27750959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 30417591 - 30417665
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || ||||||| |||||||||||||| | ||| |||||| ||||| ||||||| ||| ||||||||||| |
|
|
| T |
30417591 |
tttttttttgtggtggacggggtttgaaccccgaaccatgcatatattatacattgtctataccaactgagctaa |
30417665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 197
Target Start/End: Original strand, 30550707 - 30550765
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || ||||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
30550707 |
tttttttttgtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
30550765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 150 - 212
Target Start/End: Complemental strand, 36781477 - 36781415
Alignment:
| Q |
150 |
ggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagcta |
212 |
Q |
| |
|
|||||||||||||| ||||| |||| ||||||| |||||| ||||||| || |||||||||| |
|
|
| T |
36781477 |
ggtggtcggggtttaaaccccggactttgcatatattatgtattgtccttaccaactgagcta |
36781415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 214
Target Start/End: Complemental strand, 37938562 - 37938500
Alignment:
| Q |
152 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||||||| |||||||| |||| ||||||| |||||||||| |||||| |||||||||||| |
|
|
| T |
37938562 |
tggtcgggatttgaacctcggactttgcatatattatgcattatccataccaactgagctaaa |
37938500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 209
Target Start/End: Complemental strand, 40167402 - 40167332
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||| || ||||||| ||||||||||| || | |||||| ||| ||||||||||||||||| ||||||| |
|
|
| T |
40167402 |
tttttttttgtggtggccggggtttgaatcccgaaccttgtatatattatgcattgtccataccaactgag |
40167332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 197
Target Start/End: Original strand, 44215456 - 44215514
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || ||||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
44215456 |
tttttttttgtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
44215514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 151 - 196
Target Start/End: Original strand, 3672609 - 3672654
Alignment:
| Q |
151 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
196 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
3672609 |
gtggtcggggtttgaaccctaaaccttgcatattttatgcattgtc |
3672654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 151 - 200
Target Start/End: Complemental strand, 4830076 - 4830027
Alignment:
| Q |
151 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||||||| || |||||| | |||||||||| ||||||||||||||||| |
|
|
| T |
4830076 |
gtggtcgggattcgaaccccgaaccttgcatatattatgcattgtccata |
4830027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 161 - 214
Target Start/End: Complemental strand, 6447247 - 6447194
Alignment:
| Q |
161 |
tttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||||| | |||||||||||| ||||||||||||||||| ||||||| |||| |
|
|
| T |
6447247 |
tttgaactccggaccttgcatatattatgcattgtccataccaactgagttaaa |
6447194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 152 - 213
Target Start/End: Complemental strand, 8138002 - 8137941
Alignment:
| Q |
152 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||||||||||| || ||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
8138002 |
tggtcggggtttgaaccccaaactttgcatattttatgcattgtccataccaactgagctaa |
8137941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 139 - 200
Target Start/End: Complemental strand, 9598679 - 9598618
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||| || |||||||||||| ||||||||| || ||||| |||||||||| ||||| |||| |
|
|
| T |
9598679 |
tttttttttgtggtggtcgggatttgaaccccgggccttggatacattatgtattgttcata |
9598618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 147 - 200
Target Start/End: Complemental strand, 12061659 - 12061606
Alignment:
| Q |
147 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||| ||||| |||||||||| |
|
|
| T |
12061659 |
ggtggtggtcggactttgaaccctgaaccttgcatatattatatattgtccata |
12061606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 172 - 213
Target Start/End: Original strand, 12910820 - 12910861
Alignment:
| Q |
172 |
gaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
12910820 |
gaccttgcatatattatgcattgtccataccaactgagctaa |
12910861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 164 - 213
Target Start/End: Complemental strand, 19778120 - 19778071
Alignment:
| Q |
164 |
gaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
19778120 |
gaaccccggaccttgcatatattatgcattgtccttaccaactgagctaa |
19778071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 145 - 182
Target Start/End: Complemental strand, 30845028 - 30844991
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcata |
182 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
30845028 |
ttggtggtggtcggggtttgtaccatggaccttgcata |
30844991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 160 - 213
Target Start/End: Complemental strand, 35103165 - 35103112
Alignment:
| Q |
160 |
gtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||| |||| ||||||||||| |
|
|
| T |
35103165 |
gtttgaacctcggaccttgcttacattatgcattgttcataccaactgagctaa |
35103112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 139 - 212
Target Start/End: Original strand, 38763496 - 38763569
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagcta |
212 |
Q |
| |
|
||||| || ||||||| | ||||| |||||| ||||||||||| ||||||||||||||| | |||||||||| |
|
|
| T |
38763496 |
tttttttttgtggtggccagggttcgaaccccagaccttgcatatattatgcattgtccaaaccaactgagcta |
38763569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 139 - 196
Target Start/End: Original strand, 42172224 - 42172281
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
196 |
Q |
| |
|
||||| || |||||||| ||||||||||| | ||| |||||||| ||||||||||||| |
|
|
| T |
42172224 |
tttttttttgtggtggttggggtttgaactccggatcttgcatatattatgcattgtc |
42172281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 213
Target Start/End: Complemental strand, 574454 - 574390
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||| ||| |||| | ||||||| |||| ||||||||||||| |||| ||||||||||| |
|
|
| T |
574454 |
tggtggtcgaagttcgaactccggaccttacatatattatgcattgtctatatcaactgagctaa |
574390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 209
Target Start/End: Complemental strand, 4263873 - 4263825
Alignment:
| Q |
161 |
tttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| | ||| ||||||| |
|
|
| T |
4263873 |
tttgaacctcggaccttgcatacattatgcattgttcttatcaactgag |
4263825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 140 - 200
Target Start/End: Complemental strand, 10601842 - 10601782
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
|||| ||||| |||| ||||||||||| || | | |||||||| ||||||||||||||||| |
|
|
| T |
10601842 |
tttttttggttgtggccggggtttgaatcccgaatcttgcatatattatgcattgtccata |
10601782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 163 - 214
Target Start/End: Complemental strand, 15664567 - 15664515
Alignment:
| Q |
163 |
tgaaccctggaccttgcatacattatgcattgtcc-atataaactgagctaaa |
214 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||| ||| |||||||||||| |
|
|
| T |
15664567 |
tgaaccctagaccttgcatatattatgcattgtcctataccaactgagctaaa |
15664515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 209
Target Start/End: Complemental strand, 21557503 - 21557443
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||||||||| || ||||| ||||||| |||| ||||||||||||||||| ||||||| |
|
|
| T |
21557503 |
tggtggtcgggattcgaacctcggaccttacatatattatgcattgtccatactaactgag |
21557443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 26799254 - 26799206
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||||||||||||| ||||| | |||||||||| ||||||||||||| |
|
|
| T |
26799254 |
tggtggtcggggttttaaccccgaaccttgcatattttatgcattgtcc |
26799206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 209
Target Start/End: Complemental strand, 29546963 - 29546903
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||| ||||| ||||||| ||| ||||||| |
|
|
| T |
29546963 |
tggtggtcagggtttgaaccccagaccttgcatatattatctattgtccctatcaactgag |
29546903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 33451356 - 33451404
Alignment:
| Q |
165 |
aaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||| ||||||||||| |||||||||| |||||| ||||||||||| |
|
|
| T |
33451356 |
aacccttgaccttgcatatattatgcattatccataccaactgagctaa |
33451404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 196
Target Start/End: Complemental strand, 33996140 - 33996092
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
196 |
Q |
| |
|
||||||||||| |||||||||| | || ||||||| ||||||||||||| |
|
|
| T |
33996140 |
gtggtggtcggagtttgaaccccgaactttgcatatattatgcattgtc |
33996092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 213
Target Start/End: Complemental strand, 41625264 - 41625200
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||| |||||| ||||||| |||||| |||| |||||||||| | |||| ||||||||||| |
|
|
| T |
41625264 |
tggtggttggggttcgaaccctagaccttacatatattatgcattattcataccaactgagctaa |
41625200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 139 - 214
Target Start/End: Original strand, 44067974 - 44068049
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacatt-atgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||| |||||| |||||| |||||||||| | ||||||||||| || |||||||||||| || |||||||||||| |
|
|
| T |
44067974 |
ttttttttggtgatggtcgtggtttgaacc-tcgaccttgcatatttttatgcattgtccacatcaactgagctaaa |
44068049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 196
Target Start/End: Original strand, 44632175 - 44632223
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
196 |
Q |
| |
|
|||||||||||||||||||||| | ||||| ||| ||||||||||||| |
|
|
| T |
44632175 |
gtggtggtcggggtttgaaccccgaaccttatatatattatgcattgtc |
44632223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 51; Significance: 2e-20; HSPs: 114)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 137 - 211
Target Start/End: Complemental strand, 18684211 - 18684138
Alignment:
| Q |
137 |
tctttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagct |
211 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
18684211 |
tctttttatttatggtggtcggggtttgaaccc-ggaccttgcatacattatgcattatccatatcaactgagct |
18684138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 132 - 212
Target Start/End: Original strand, 27462410 - 27462490
Alignment:
| Q |
132 |
tgaagtctttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagcta |
212 |
Q |
| |
|
|||| ||||||| || ||||||| |||||||||||||| |||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
27462410 |
tgaactctttttttttgtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccataccaactgagcta |
27462490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 3830148 - 3830074
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || ||||||| |||||||||||||||||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
3830148 |
tttttttttgtggtggctggggtttgaaccctggaccttgcatatattatgcattgtccctacaaactgagctaa |
3830074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 19416594 - 19416520
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| |||||||||| |||||||||||||| |||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
19416594 |
ttttttttggtggtggccggggtttgaaccccggaccttgcatattttatgcattgtccataccaactgagctaa |
19416520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 31038503 - 31038577
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| |||||||||| |||||||||||||| ||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
31038503 |
ttttttttggtggtggccggggtttgaaccccagaccttgcatacaatatgcattgtccataccaactgagctaa |
31038577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 150 - 214
Target Start/End: Complemental strand, 19599214 - 19599150
Alignment:
| Q |
150 |
ggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||||||| ||||||| |||| |
|
|
| T |
19599214 |
ggtggtcggggtttgaaccccggaccttgcatatattatgcattgtccataccaactgagttaaa |
19599150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 145 - 193
Target Start/End: Complemental strand, 21322249 - 21322201
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcatt |
193 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21322249 |
ttggtggtggccggggtttgaaccctggaccttgcatacattatgcatt |
21322201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 3671904 - 3671830
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||||| |||||||||||| |||| |||||||||| |
|
|
| T |
3671904 |
tttttattggtggtggtcggggtttgaactccagaccttgcatatattatgcattgttcataccgactgagctaa |
3671830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 139 - 197
Target Start/End: Complemental strand, 18023759 - 18023701
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || ||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18023759 |
tttttttttgtggtggtcggagtttgaaccctggaccttgcatatattatgcattgtcc |
18023701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 138 - 212
Target Start/End: Original strand, 45046195 - 45046269
Alignment:
| Q |
138 |
ctttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagcta |
212 |
Q |
| |
|
|||||| |||||||||||| | |||||||||| |||||||||||| |||||| | ||||||||| |||||||||| |
|
|
| T |
45046195 |
cttttttttggtggtggtcagagtttgaaccccggaccttgcatatattatgtactgtccatatcaactgagcta |
45046269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 140 - 213
Target Start/End: Complemental strand, 18714527 - 18714454
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||| ||||||||| |||||||||||||| |||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
18714527 |
tttttttggtggtgtacggggtttgaaccccggaccttgcatatattatgcattgtccttaccaactgagctaa |
18714454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 139 - 208
Target Start/End: Original strand, 18773737 - 18773806
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactga |
208 |
Q |
| |
|
||||| || |||||||||||||||||||||| ||||||| |||| ||||||||||||||||| |||||| |
|
|
| T |
18773737 |
tttttttttgtggtggtcggggtttgaaccccggaccttacatattttatgcattgtccatatcaactga |
18773806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 147 - 212
Target Start/End: Original strand, 27833390 - 27833455
Alignment:
| Q |
147 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagcta |
212 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||| |||||||||||||| || |||||||||| |
|
|
| T |
27833390 |
ggtggtggtcggggtttgaaccccggaccttacatatattatgcattgtccttaccaactgagcta |
27833455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 139 - 199
Target Start/End: Complemental strand, 28230859 - 28230799
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccat |
199 |
Q |
| |
|
||||| || ||||||||||| |||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
28230859 |
tttttttttgtggtggtcggtgtttgaaccccggaccttgcatacatcatgcattgtccat |
28230799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 145 - 213
Target Start/End: Complemental strand, 46737859 - 46737791
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| |||| ||| |||||||||| |||||||||||| ||||||||||||||| | |||||||||||| |
|
|
| T |
46737859 |
ttggtagtggccggtgtttgaaccccggaccttgcatatattatgcattgtccaaacaaactgagctaa |
46737791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 158 - 213
Target Start/End: Complemental strand, 10244788 - 10244733
Alignment:
| Q |
158 |
gggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
10244788 |
gggtttgaaccccggaccttgcatatattatgcattgtccataccaactgagctaa |
10244733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 147 - 213
Target Start/End: Complemental strand, 5579765 - 5579699
Alignment:
| Q |
147 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||| ||||| || ||||||||||| |
|
|
| T |
5579765 |
ggtggtggtcggggtttgaaccccagaccttgcatatattatgcactgtccctaccaactgagctaa |
5579699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 140 - 214
Target Start/End: Complemental strand, 8227428 - 8227354
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||| ||||||||||||| | || ||||||||||| || |||| |||||||||||||| ||| |||||||||||| |
|
|
| T |
8227428 |
tttttttggtggtggtcgagattcgaaccctggactttacatatattatgcattgtccttatcaactgagctaaa |
8227354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 159 - 213
Target Start/End: Original strand, 42095944 - 42095998
Alignment:
| Q |
159 |
ggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||| ||||||||||||| |||||| |
|
|
| T |
42095944 |
ggtttgaaccccggaccttgcatatattatgcatggtccatataaactaagctaa |
42095998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 140 - 213
Target Start/End: Complemental strand, 6023388 - 6023315
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||| ||||||||||||||||||||||||| | |||||||||| ||| |||||||||| | ||||||||||| |
|
|
| T |
6023388 |
tttttttggtggtggtcggggtttgaaccccgaaccttgcatattttaagcattgtccaaaccaactgagctaa |
6023315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 148 - 193
Target Start/End: Complemental strand, 10242551 - 10242506
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcatt |
193 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10242551 |
gtggtgatcggggtttgaaccctggaccttgcatatattatgcatt |
10242506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 156 - 213
Target Start/End: Original strand, 38374189 - 38374246
Alignment:
| Q |
156 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||||||||| || |||||||| |
|
|
| T |
38374189 |
cggggtttgaaccctggaccttgcatatactatgcattgtccataccaattgagctaa |
38374246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 140 - 213
Target Start/End: Complemental strand, 39801785 - 39801712
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||| ||||||||||| |||||| | |||| ||| |||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
39801785 |
tttttttggtggtggttggggttcgtaccccggatcttgcatatattatgcattgtccataccaactgagctaa |
39801712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 156 - 200
Target Start/End: Complemental strand, 6781870 - 6781826
Alignment:
| Q |
156 |
cggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6781870 |
cggggtttgaaccctggaccttgcatattttatgcattgtccata |
6781826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 145 - 213
Target Start/End: Complemental strand, 7670508 - 7670440
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| ||||||| ||||||||||| |||||||||||| |||||||||||| || | ||||||||||| |
|
|
| T |
7670508 |
ttggtagtggtcgaggtttgaaccccggaccttgcatatattatgcattgttcaaaccaactgagctaa |
7670440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 140 - 200
Target Start/End: Complemental strand, 8084506 - 8084446
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
|||| |||||||||| ||||||| |||||| |||||||||||| |||||||||||||||| |
|
|
| T |
8084506 |
tttttttggtggtggccggggttcgaaccccggaccttgcatattttatgcattgtccata |
8084446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 145 - 197
Target Start/End: Original strand, 33473508 - 33473560
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
|||||||||| | ||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
33473508 |
ttggtggtggccagggttggaaccctggaccttgcatatattatgcattgtcc |
33473560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 137 - 213
Target Start/End: Original strand, 43346543 - 43346619
Alignment:
| Q |
137 |
tctttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||| |||||||||| ||||||||| ||| ||| ||| |||| ||||||||||||||||| ||||||||||| |
|
|
| T |
43346543 |
tcttttttttggtggtggatggggtttgatccccggatcttacatatattatgcattgtccataccaactgagctaa |
43346619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 48629056 - 48629104
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||| |||||||||||||| |
|
|
| T |
48629056 |
tggtggtcggggtttaaaccccggaccttgcatatattatgcattgtcc |
48629104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 149 - 200
Target Start/End: Complemental strand, 7735600 - 7735549
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
7735600 |
tggtggtcgggctttgaaccctagaccttgcatattttatgcattgtccata |
7735549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 139 - 198
Target Start/End: Complemental strand, 10026074 - 10026015
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcca |
198 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
10026074 |
ttttttttggtggtggtcggggtttgaaccccataccttgcatattttatgcattgtcca |
10026015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 151 - 198
Target Start/End: Original strand, 34448603 - 34448650
Alignment:
| Q |
151 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtcca |
198 |
Q |
| |
|
|||||| |||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
34448603 |
gtggtcagggtttgaaccctggaccttacatatattatgcattgtcca |
34448650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 146 - 197
Target Start/End: Original strand, 47155092 - 47155143
Alignment:
| Q |
146 |
tggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
47155092 |
tggtggtgtccggggttcgaaccctggaccttgcatatattatgcattgtcc |
47155143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 139 - 214
Target Start/End: Original strand, 47607891 - 47607966
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||| || ||||||| ||| ||||||||||||||||||||||| |||||| | ||||| || |||||||||||| |
|
|
| T |
47607891 |
tttttttttgtggtggccggagtttgaaccctggaccttgcatatattatgtaatgtccctaccaactgagctaaa |
47607966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 145 - 187
Target Start/End: Complemental strand, 145592 - 145550
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacatta |
187 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
145592 |
ttggtggtggtcggggtttgaaccccggaccttgcatatatta |
145550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 21105683 - 21105609
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || ||||||||||||||| ||||| | |||||||||| |||||||||| |||||| ||||||||||| |
|
|
| T |
21105683 |
tttttttttgtggtggtcggggttcgaacctcgaaccttgcatatattatgcattttccataccaactgagctaa |
21105609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 193
Target Start/End: Original strand, 21554915 - 21554969
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcatt |
193 |
Q |
| |
|
||||| || ||||||||||||||||||| ||||||||||||||| |||| ||||| |
|
|
| T |
21554915 |
tttttttttgtggtggtcggggtttgaatcctggaccttgcatatattaagcatt |
21554969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 30006073 - 30006147
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || |||||||| ||||||||||||| ||||||||||||||||||||| | |||| ||||||||||| |
|
|
| T |
30006073 |
tttttttttgtggtggttggggtttgaaccccaaaccttgcatacattatgcattattcataccaactgagctaa |
30006147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 147 - 213
Target Start/End: Original strand, 35142138 - 35142204
Alignment:
| Q |
147 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||||||||| ||||| || ||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
35142138 |
ggtggtggtcggggttcgaacctcaaactttgcatatattatgcattgtccatatcaactgagctaa |
35142204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 193
Target Start/End: Original strand, 37495899 - 37495953
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcatt |
193 |
Q |
| |
|
||||| ||| ||||||||||| |||||||| ||||||||||||| |||||||||| |
|
|
| T |
37495899 |
tttttcttgttggtggtcgggatttgaaccttggaccttgcatatattatgcatt |
37495953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 209
Target Start/End: Original strand, 42829215 - 42829285
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||| || ||||||| ||| |||||||||| ||| |||||||| |||||||||||||| ||| ||||||| |
|
|
| T |
42829215 |
tttttttttgtggtggccggagtttgaaccccggagcttgcatatattatgcattgtccctatcaactgag |
42829285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 147 - 213
Target Start/End: Complemental strand, 46987158 - 46987092
Alignment:
| Q |
147 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||| ||||||| |||||| |||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
46987158 |
ggtggtgtccggggttcgaaccccggaccttgcatatattatgcattgtccttaccaactgagctaa |
46987092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 140 - 201
Target Start/End: Complemental strand, 11893213 - 11893152
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatat |
201 |
Q |
| |
|
|||| |||||||||||| |||||| |||| | ||||||||||| ||||||||||||||||| |
|
|
| T |
11893213 |
tttttttggtggtggtcagggtttaaaccgtagaccttgcatattttatgcattgtccatat |
11893152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 145 - 198
Target Start/End: Original strand, 19626512 - 19626565
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcca |
198 |
Q |
| |
|
||||| |||| ||| |||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
19626512 |
ttggtagtggccggtgtttgaaccccggaccttgcatatattatgcattgtcca |
19626565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 139 - 212
Target Start/End: Complemental strand, 25288744 - 25288671
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagcta |
212 |
Q |
| |
|
||||| || ||||||| ||| ||||||| | |||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
25288744 |
tttttttttgtggtggctgggatttgaactccggaccttgcatatcttatgcattgtccatatcaactgagcta |
25288671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 148 - 193
Target Start/End: Original strand, 26717918 - 26717963
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcatt |
193 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||| |||||||||| |
|
|
| T |
26717918 |
gtggtggtcagagtttgaaccctggaccttgcatatattatgcatt |
26717963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 149 - 214
Target Start/End: Complemental strand, 42336140 - 42336075
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||||||| | || |||||| ||||||||||| |||||||||||||| ||| |||||||||||| |
|
|
| T |
42336140 |
tggtggtcgagattcgaaccccggaccttgcatgtattatgcattgtccttatcaactgagctaaa |
42336075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 137 - 214
Target Start/End: Complemental strand, 45425535 - 45425458
Alignment:
| Q |
137 |
tctttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||||| |||||||||| |||| || |||||| | |||||||||| ||||||||||||| ||| ||||||| |||| |
|
|
| T |
45425535 |
tctttttgttggtggtggccgggattcgaaccccgaaccttgcatatattatgcattgtctttatcaactgagttaaa |
45425458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 145 - 198
Target Start/End: Complemental strand, 46371055 - 46371002
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcca |
198 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||| ||| |||||||||| |||| |
|
|
| T |
46371055 |
ttggtggtggtcggagtttgaaccccggaccttggatatattatgcattatcca |
46371002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 145 - 198
Target Start/End: Original strand, 47342421 - 47342474
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcca |
198 |
Q |
| |
|
||||| |||||||| |||||||| | |||||||||||| ||||||||||||||| |
|
|
| T |
47342421 |
ttggtagtggtcggagtttgaactccggaccttgcatatattatgcattgtcca |
47342474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 145 - 197
Target Start/End: Complemental strand, 3584278 - 3584226
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
|||||||||||||||||||||| | | |||||||||| |||||||||||||| |
|
|
| T |
3584278 |
ttggtggtggtcggggtttgaatctcgtaccttgcatatattatgcattgtcc |
3584226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 140 - 200
Target Start/End: Complemental strand, 6579697 - 6579637
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||| | |||||||||| |||| ||||||||||| |
|
|
| T |
6579697 |
tttttttggtggtggtcggggtttgaaccttacaccttgcatattttatacattgtccata |
6579637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 213
Target Start/End: Original strand, 40752830 - 40752894
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||| ||||||| |||||| |||| ||||||| |||||| |||||||||| ||||||||||| |
|
|
| T |
40752830 |
tggtggccggggttcgaaccccggacattgcatatattatgtattgtccatactaactgagctaa |
40752894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 213
Target Start/End: Complemental strand, 41029342 - 41029278
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||| || |||||| |||||||||||| ||||| |||||||| || ||||||||||| |
|
|
| T |
41029342 |
tggtggtcgggattcgaaccccggaccttgcatatattatacattgtccttaccaactgagctaa |
41029278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 148 - 200
Target Start/End: Complemental strand, 45088946 - 45088895
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||||||| |||| |
|
|
| T |
45088946 |
gtggtggtcggggtttgaaccc-cgaccttgcatatattatgcattgttcata |
45088895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 139 - 214
Target Start/End: Original strand, 16577841 - 16577916
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||| || ||||||| || ||||||||||| ||||||||||| |||||| ||||||| || |||||||||||| |
|
|
| T |
16577841 |
tttttttttgtggtggccgaggtttgaaccccagaccttgcatatattatgtattgtccctaccaactgagctaaa |
16577916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 139 - 214
Target Start/End: Complemental strand, 16587821 - 16587746
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||| || ||||||| || ||||||||||| ||||||||||| |||||| ||||||| || |||||||||||| |
|
|
| T |
16587821 |
tttttttttgtggtggccgaggtttgaaccccagaccttgcatatattatgtattgtccctaccaactgagctaaa |
16587746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 157 - 196
Target Start/End: Original strand, 20085758 - 20085797
Alignment:
| Q |
157 |
ggggtttgaaccctggaccttgcatacattatgcattgtc |
196 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
20085758 |
ggggtttgaaccccggaccttgcatatattatgcattgtc |
20085797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 138 - 209
Target Start/End: Original strand, 30793026 - 30793097
Alignment:
| Q |
138 |
ctttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
|||||| || |||||||||||| || ||||||| |||| |||||| | ||||||||||||||| ||||||| |
|
|
| T |
30793026 |
ctttttttttgtggtggtcgggattcgaaccctagaccatgcatatactatgcattgtccataccaactgag |
30793097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 147 - 214
Target Start/End: Original strand, 41250036 - 41250103
Alignment:
| Q |
147 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||||| |||||| ||||||| |||||||||||| ||||| |||||| | ||| |||||||||||| |
|
|
| T |
41250036 |
ggtggtgttcggggcttgaacctcggaccttgcatatattatacattgttcttatcaactgagctaaa |
41250103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 137 - 192
Target Start/End: Complemental strand, 43139347 - 43139292
Alignment:
| Q |
137 |
tctttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcat |
192 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||| | |||||||||| |||||||| |
|
|
| T |
43139347 |
tcttttttttggtagtggtcggggtttgaaccccgtaccttgcatattttatgcat |
43139292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 158 - 213
Target Start/End: Original strand, 43539104 - 43539159
Alignment:
| Q |
158 |
gggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||||| ||||||| |||| |||||||||||| | ||| ||||||||||| |
|
|
| T |
43539104 |
gggtttgaaccccggaccttacatatattatgcattgttcctatcaactgagctaa |
43539159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 139 - 214
Target Start/End: Original strand, 43629059 - 43629134
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||| |||||||||| |||||| ||| || || ||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
43629059 |
ttttttttggtggtggatggggttagaatccaagatcttgcatacattatgtattgtccatactaactgagctaaa |
43629134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 580907 - 580981
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || ||||||||||||||| |||| | ||| |||||||| |||||||||||||||| ||| ||||||| |
|
|
| T |
580907 |
tttttttttgtggtggtcggggttcgaacgccggatcttgcatattttatgcattgtccataccaaccgagctaa |
580981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 208
Target Start/End: Original strand, 4885878 - 4885950
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcata---cattatgcattgtccatataaactga |
208 |
Q |
| |
|
||||| || ||||||||||||||| ||||||||||||| | ||| ||||||||||||||||| ||||||| |
|
|
| T |
4885878 |
tttttttttgtggtggtcggggttcgaaccctggacctcgaatatattattatgcattgtccatacaaactga |
4885950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 5458052 - 5458126
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || |||||| ||| |||||||| || ||||||||||| |||||||||||| | ||| ||||||||||| |
|
|
| T |
5458052 |
tttttttttgtggtgttcgaggtttgaatcccagaccttgcatatattatgcattgttcttatcaactgagctaa |
5458126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 197
Target Start/End: Original strand, 7388020 - 7388078
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || ||||||||||||||||||| || | ||||| |||| |||||||||||||| |
|
|
| T |
7388020 |
tttttttttgtggtggtcggggtttgaatcccgaaccttacatatattatgcattgtcc |
7388078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 200
Target Start/End: Original strand, 8290450 - 8290512
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcata-cattatgcattgtccata |
200 |
Q |
| |
|
||||| || |||||||||||| || |||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
8290450 |
tttttttttgtggtggtcgggattcgaaccccggaccttgcatattattatgcattgtccata |
8290512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 140 - 213
Target Start/End: Complemental strand, 20243335 - 20243261
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatac-attatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||| ||||||||| ||||||| ||||| |||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
20243335 |
tttttttggtggtgtccggggttcaaaccccggaccttgcatattattatgcattgtccataccaactgagctaa |
20243261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 197
Target Start/End: Complemental strand, 20763234 - 20763176
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || ||||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
20763234 |
tttttttttgtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
20763176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 21174439 - 21174365
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| |||||||||| |||||||||||||| ||| ||| |||| | ||| |||||||| || ||||||||||| |
|
|
| T |
21174439 |
ttttttttggtggtggccggggtttgaaccccggaactttcatatagtattcattgtccctaccaactgagctaa |
21174365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 214
Target Start/End: Original strand, 23198743 - 23198805
Alignment:
| Q |
152 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||||||||||||||||| |||| ||||||| ||||||||||| |||| ||||||| |||| |
|
|
| T |
23198743 |
tggtcggggtttgaaccccggactttgcatattttatgcattgttcataccaactgagttaaa |
23198805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 197
Target Start/End: Complemental strand, 29488800 - 29488742
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || ||||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
29488800 |
tttttttttgtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
29488742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 189
Target Start/End: Complemental strand, 29986677 - 29986627
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatg |
189 |
Q |
| |
|
||||| ||| |||||| |||||||||||||||||||||||| || |||||| |
|
|
| T |
29986677 |
ttttttttgttggtggacggggtttgaaccctggaccttgcgtatattatg |
29986627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 197
Target Start/End: Complemental strand, 30623040 - 30622994
Alignment:
| Q |
151 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
|||||||||||||||||| | ||||||||||| |||||| ||||||| |
|
|
| T |
30623040 |
gtggtcggggtttgaaccatagaccttgcatatattatgtattgtcc |
30622994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 148 - 214
Target Start/End: Complemental strand, 30857319 - 30857253
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||||||| ||||||||||| | |||||||||| ||||||||||||||||| |||| ||||||| |
|
|
| T |
30857319 |
gtggtggttggggtttgaactcaaaaccttgcatatattatgcattgtccataccaactaagctaaa |
30857253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 197
Target Start/End: Original strand, 33232378 - 33232436
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || ||||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
33232378 |
tttttttttgtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
33232436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 33610906 - 33610980
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || ||||||| ||| ||| |||| | |||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
33610906 |
tttttttttgtggtggccggtgttcgaactccggaccttgcatatattatgcattgtccgtaacaactgagctaa |
33610980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 197
Target Start/End: Original strand, 34284520 - 34284578
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || ||||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
34284520 |
tttttttttgtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
34284578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 209
Target Start/End: Complemental strand, 37624623 - 37624553
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||| || ||||||| |||| || |||||| ||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
37624623 |
tttttttttgtggtggccgggattcgaacccccgaccttgcatatattatgcattgtccataccaactgag |
37624553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 213
Target Start/End: Original strand, 39926539 - 39926593
Alignment:
| Q |
159 |
ggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||| | || ||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
39926539 |
ggtttgaaccccgaacattgcatatattatgcattgtccttatcaactgagctaa |
39926593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 209
Target Start/End: Original strand, 41237905 - 41237975
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||| ||||||||||||| |||||||||| | |||||||||| |||| | |||||||||| ||||||| |
|
|
| T |
41237905 |
ttttttttggtggtggtcgaggtttgaacctcgaaccttgcatatattacgtattgtccataccaactgag |
41237975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 172 - 214
Target Start/End: Original strand, 44558788 - 44558830
Alignment:
| Q |
172 |
gaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
44558788 |
gaccttgcatatattatgcattgtccataccaactgagctaaa |
44558830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 209
Target Start/End: Complemental strand, 48527270 - 48527200
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||| || ||||||| |||| || |||| | |||||||||||| |||||||||||||| ||| ||||||| |
|
|
| T |
48527270 |
tttttttttgtggtggccgggattcgaactccggaccttgcatatattatgcattgtccttatcaactgag |
48527200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 145 - 214
Target Start/End: Original strand, 3672539 - 3672608
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||||||| || ||||||||||| | |||||||| |||||| ||||||||||| |||||||||||| |
|
|
| T |
3672539 |
ttggtggtgtccgaggtttgaaccccatatcttgcatatattatgtattgtccatatcaactgagctaaa |
3672608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 148 - 201
Target Start/End: Complemental strand, 12167478 - 12167425
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatat |
201 |
Q |
| |
|
|||||||| |||||||||| || |||||||| ||| |||||||||||| ||||| |
|
|
| T |
12167478 |
gtggtggttggggtttgaatcccggaccttgaatatattatgcattgttcatat |
12167425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 152 - 213
Target Start/End: Complemental strand, 12320250 - 12320189
Alignment:
| Q |
152 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
12320250 |
tggtcggggtttgaacttgagaccttgcataaattatgcattgtccctaccaactgagctaa |
12320189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 140 - 213
Target Start/End: Complemental strand, 14786202 - 14786129
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||| ||| ||||||||||| |||||| || || ||||||||||||| ||||||| |||| ||||||||||| |
|
|
| T |
14786202 |
tttttttgttggtggtcgggatttgaatcccagaacttgcatacattaagcattgttcataccaactgagctaa |
14786129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 152 - 201
Target Start/End: Complemental strand, 21580883 - 21580834
Alignment:
| Q |
152 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatat |
201 |
Q |
| |
|
||||||||||||||||| | ||||| |||| |||||||||||||||||| |
|
|
| T |
21580883 |
tggtcggggtttgaaccatataccttacatatattatgcattgtccatat |
21580834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 139 - 196
Target Start/End: Original strand, 28736614 - 28736671
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
196 |
Q |
| |
|
||||| || |||||||| |||||||||||| |||||||||||| || |||||||||| |
|
|
| T |
28736614 |
tttttttttgtggtggttggggtttgaacctcggaccttgcatatatcatgcattgtc |
28736671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 159 - 212
Target Start/End: Original strand, 29237558 - 29237611
Alignment:
| Q |
159 |
ggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagcta |
212 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||| | || |||||||||| |
|
|
| T |
29237558 |
ggttcgaaccctggaccttgcatatattatgcattgttcttaccaactgagcta |
29237611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 152 - 209
Target Start/End: Complemental strand, 29726867 - 29726810
Alignment:
| Q |
152 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
|||||||||||||||||| | |||||||||| ||||| |||||| ||| | ||||||| |
|
|
| T |
29726867 |
tggtcggggtttgaaccccgaaccttgcatatattatacattgttcatgtcaactgag |
29726810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 140 - 197
Target Start/End: Original strand, 29926390 - 29926447
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
|||| |||||||||| | | ||||||||||||||| ||||||| || ||||||||||| |
|
|
| T |
29926390 |
ttttcttggtggtggccagagtttgaaccctggacattgcatatatcatgcattgtcc |
29926447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 157 - 214
Target Start/End: Complemental strand, 35222986 - 35222929
Alignment:
| Q |
157 |
ggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||||||||||| ||||||||||| || ||||||||||| ||| |||||| ||||| |
|
|
| T |
35222986 |
ggggtttgaaccccagaccttgcatatatcatgcattgtccctatcaactgacctaaa |
35222929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 139 - 192
Target Start/End: Complemental strand, 36121732 - 36121679
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcat |
192 |
Q |
| |
|
||||| ||||| |||| |||||||||||||| |||||||||||| |||||||| |
|
|
| T |
36121732 |
ttttttttggtagtggccggggtttgaaccccggaccttgcatattttatgcat |
36121679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 152 - 209
Target Start/End: Original strand, 37516796 - 37516853
Alignment:
| Q |
152 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
|||||| ||||||||| | |||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
37516796 |
tggtcgaggtttgaactccggaccttgcatatgttatgcattgtccatactaactgag |
37516853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 160 - 213
Target Start/End: Original strand, 39280820 - 39280873
Alignment:
| Q |
160 |
gtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| | || ||||||||||| |
|
|
| T |
39280820 |
gtttgaaccccggaccttgcatatattatgcattgttcttaccaactgagctaa |
39280873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 140 - 197
Target Start/End: Original strand, 40187618 - 40187675
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
|||| ||||||||| |||||||||||||| |||||| |||| |||||||||||||| |
|
|
| T |
40187618 |
tttttttggtggtgttcggggtttgaaccgcagaccttacatatattatgcattgtcc |
40187675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 160 - 200
Target Start/End: Complemental strand, 5041398 - 5041358
Alignment:
| Q |
160 |
gtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
5041398 |
gtttgaaccccagaccttgcatatattatgcattgtccata |
5041358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 213
Target Start/End: Complemental strand, 5526795 - 5526731
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||||||||||||| | ||| ||| ||||||||||||||||| ||||||||||| |
|
|
| T |
5526795 |
tggtggtcggggtttgaaccccaaatcttatatatattatgcattgtccataccaactgagctaa |
5526731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 213
Target Start/End: Original strand, 7872735 - 7872803
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||| | ||||| |||||| ||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
7872735 |
ttggtggtgtcctgggttcgaaccccagaccttgcatatattatgcattgtccttaccaactgagctaa |
7872803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 189
Target Start/End: Original strand, 7994871 - 7994915
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatg |
189 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||| |||||| |
|
|
| T |
7994871 |
ttggtggtggtcggggtttgaaccccagaccttacatatattatg |
7994915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 213
Target Start/End: Complemental strand, 9522982 - 9522918
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||| ||||||| |||||| |||||||||| |||||||||||| |||| ||||||||||| |
|
|
| T |
9522982 |
tggtggccggggttcgaaccccaaaccttgcatatattatgcattgttcataccaactgagctaa |
9522918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 139 - 195
Target Start/End: Original strand, 10236886 - 10236942
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
||||| ||||||||| ||||||| ||||| | ||||||||||||||||||||||| |
|
|
| T |
10236886 |
ttttttttggtggtgtccggggttcgaacctcgaaccttgcatacattatgcattgt |
10236942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 213
Target Start/End: Complemental strand, 10327023 - 10326960
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||| || |||||||||| ||||||||||||| |||||||||||| || | ||||||||||| |
|
|
| T |
10327023 |
tggtggccgaggtttgaacc-tggaccttgcatatattatgcattgttcacaccaactgagctaa |
10326960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 213
Target Start/End: Complemental strand, 14671241 - 14671174
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatata--aactgagctaa |
213 |
Q |
| |
|
|||||| ||||| || |||||| |||||||| ||| |||||||||||||| |||| ||||||||||| |
|
|
| T |
14671241 |
gtggtgatcgggattcgaaccccggaccttgtatatattatgcattgtccttatactaactgagctaa |
14671174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 213
Target Start/End: Complemental strand, 17883958 - 17883894
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||| ||| |||||||||| ||||||||||| ||||| |||| ||||||| || |||||||| |
|
|
| T |
17883958 |
tggtggccggagtttgaacccaagaccttgcatatattatacattatccatatcaagtgagctaa |
17883894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 213
Target Start/End: Original strand, 18505649 - 18505712
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||| |||||||||||||||| ||| |||||||| ||||||||||||| || ||||||||||| |
|
|
| T |
18505649 |
tggtagtcggggtttgaaccc-ggatcttgcatattttatgcattgtccctaccaactgagctaa |
18505712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 193
Target Start/End: Original strand, 26529682 - 26529726
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcatt |
193 |
Q |
| |
|
||||||||||||||| ||||| | |||||||||| |||||||||| |
|
|
| T |
26529682 |
tggtggtcggggtttaaaccccgaaccttgcatatattatgcatt |
26529726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 137 - 197
Target Start/End: Original strand, 30028073 - 30028133
Alignment:
| Q |
137 |
tctttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||||| ||||||||| |||||||||||| ||||||||||| | ||||| |||||||| |
|
|
| T |
30028073 |
tcttttttttggtggtgtccggggtttgaactttggaccttgcagatattatacattgtcc |
30028133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 213
Target Start/End: Complemental strand, 30033888 - 30033820
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||||||| || |||||| ||||||||| | |||||||||||| | || ||||||||||| |
|
|
| T |
30033888 |
ttggtggtggtcgggattgaaaccctagaccttgcaaatattatgcattgttcttaccaactgagctaa |
30033820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 209
Target Start/End: Original strand, 36341052 - 36341116
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||| ||| ||||||||||| |||| ||||||| |
|
|
| T |
36341052 |
ttggtggtggtcgaggtttgaactccggaccttgtatattttatgcattgttcataccaactgag |
36341116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 197
Target Start/End: Original strand, 42227792 - 42227844
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
|||||||||||||| ||||||||| | ||||| |||| |||||||||||||| |
|
|
| T |
42227792 |
ttggtggtggtcggagtttgaacctcgaaccttacatatattatgcattgtcc |
42227844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 158 - 214
Target Start/End: Original strand, 43680990 - 43681046
Alignment:
| Q |
158 |
gggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||||| || ||||||| |||| |
|
|
| T |
43680990 |
gggtttgaaccctagaccttgcatattttatgcattgtcccaatcaactgagttaaa |
43681046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 51; Significance: 2e-20; HSPs: 91)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 15889491 - 15889417
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
15889491 |
ttttttttggtggtggtcggggtttgaaccctagaccttgcatatattatgcattgtccctaccaactgagctaa |
15889417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 22522782 - 22522856
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| |||||||||| |||||||||||||| |||||||||||| ||||||||||||||||| ||| ||||||| |
|
|
| T |
22522782 |
ttttttttggtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccataccaaccgagctaa |
22522856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 40715930 - 40716004
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || ||||||| |||||||||||||| |||||||||||| |||||||||||||||||| || |||||||| |
|
|
| T |
40715930 |
tttttttttgtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccatatcaattgagctaa |
40716004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 145 - 213
Target Start/End: Original strand, 3445234 - 3445302
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| |||| ||||||||| ||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
3445234 |
ttggtggtggccgggatttgaaccccggaccttgcatacattatgcattgtccttaccaactgagctaa |
3445302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 32200428 - 32200502
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| ||| |||||||||||| |||||||| |||||||||||| |||||||||||||| | | ||||||||||| |
|
|
| T |
32200428 |
ttttttttgttggtggtcggggcttgaaccccggaccttgcatatattatgcattgtccctgtcaactgagctaa |
32200502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 140 - 213
Target Start/End: Complemental strand, 6624855 - 6624782
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||| |||||||||| ||||||| |||||| |||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
6624855 |
tttttttggtggtggccggggttcgaaccccggaccttgcatatattatgcattgtccatgccaactgagctaa |
6624782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 145 - 213
Target Start/End: Complemental strand, 6489081 - 6489013
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
6489081 |
ttggtggtggccggggtttgaaccccagaccttgcatatattatgcattgtccctaccaactgagctaa |
6489013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 145 - 209
Target Start/End: Complemental strand, 29695089 - 29695025
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
|||||||||||||||||||||||| | ||||| |||| |||||||||||||||||| ||||||| |
|
|
| T |
29695089 |
ttggtggtggtcggggtttgaaccacgaaccttacatatattatgcattgtccatatcaactgag |
29695025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 145 - 213
Target Start/End: Complemental strand, 34436925 - 34436857
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| |||||||||||||| || ||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
34436925 |
ttggtggtgggcggggtttgaaccccggcccttgcatatattatgcattgtccctaccaactgagctaa |
34436857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 139 - 211
Target Start/End: Complemental strand, 35413036 - 35412965
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagct |
211 |
Q |
| |
|
||||| || ||||||| ||||||| |||||| |||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
35413036 |
tttttttttgtggtggccggggttcgaaccc-ggaccttgcatatattatgcattgtccatattaactgagct |
35412965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 145 - 213
Target Start/End: Complemental strand, 39980582 - 39980514
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||| ||||||||| |||||| ||||||||||| |
|
|
| T |
39980582 |
ttggtggtggtcggggtttgaactccggaccttgcatattttatgcattatccataccaactgagctaa |
39980514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 139 - 209
Target Start/End: Complemental strand, 13864424 - 13864354
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||| || |||||||||||||||||||||| |||||||||||| |||||| ||||| |||| ||||||| |
|
|
| T |
13864424 |
tttttttttgtggtggtcggggtttgaaccccggaccttgcatatattatgtattgttcataccaactgag |
13864354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 16701562 - 16701636
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || ||||||||||||||||||| || |||||||||||| ||||| |||||||| || ||||||||||| |
|
|
| T |
16701562 |
tttttttttgtggtggtcggggtttgaatcccggaccttgcatatattattcattgtccctaccaactgagctaa |
16701636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 17090946 - 17090872
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || ||||||| |||||||||||||| ||||||||||| |||||||||| |||||| ||||||||||| |
|
|
| T |
17090946 |
tttttttttgtggtggccggggtttgaaccccggaccttgcattaattatgcattatccataccaactgagctaa |
17090872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 24408575 - 24408501
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| ||||| ||||||||||||||||||| ||||||||||| ||||||||| ||||| | ||||||||||| |
|
|
| T |
24408575 |
ttttttttggtagtggtcggggtttgaaccccagaccttgcatatattatgcatcgtccaaaccaactgagctaa |
24408501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 145 - 211
Target Start/End: Complemental strand, 26655538 - 26655472
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagct |
211 |
Q |
| |
|
|||||||||| ||||||| |||||| ||||||| |||| ||||||||||||||||| ||||||||| |
|
|
| T |
26655538 |
ttggtggtggccggggttcgaaccccggaccttacatatattatgcattgtccataccaactgagct |
26655472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 145 - 211
Target Start/End: Complemental strand, 26927123 - 26927057
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagct |
211 |
Q |
| |
|
|||||||||| ||||||| |||||| ||||||| |||| ||||||||||||||||| ||||||||| |
|
|
| T |
26927123 |
ttggtggtggccggggttcgaaccccggaccttacatatattatgcattgtccataccaactgagct |
26927057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 152 - 201
Target Start/End: Complemental strand, 16076498 - 16076449
Alignment:
| Q |
152 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatat |
201 |
Q |
| |
|
||||||||| |||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
16076498 |
tggtcggggattgaaccctgaaccttgcatatattatgcattgtccatat |
16076449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 148 - 213
Target Start/End: Complemental strand, 37932401 - 37932336
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||| | ||||| |||||| |||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
37932401 |
gtggtggccagggttcgaaccccggaccttgcatatattatgcattgtccataccaactgagctaa |
37932336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 139 - 195
Target Start/End: Complemental strand, 14474914 - 14474858
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
||||| || ||||||| ||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
14474914 |
tttttttttgtggtggccggggtttgaaccctggaccttgcatatattatgcgttgt |
14474858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 149 - 209
Target Start/End: Complemental strand, 20721120 - 20721060
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||| |||||| |||||||||| ||||||| |
|
|
| T |
20721120 |
tggtagtcggggtttgaaccccggaccttgcatatattatgtattgtccataccaactgag |
20721060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 149 - 213
Target Start/End: Complemental strand, 26409323 - 26409259
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||| ||||||| |||||| ||||||| |||| ||||||||||||||||| ||||||||||| |
|
|
| T |
26409323 |
tggtgggcggggttcgaaccccggaccttacatatattatgcattgtccataccaactgagctaa |
26409259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 4009947 - 4009872
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacatt-atgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| |||||||||| |||||||||||||| || ||||||||| ||| ||||||||||| || ||||||||||| |
|
|
| T |
4009947 |
ttttttttggtggtggccggggtttgaaccccggcccttgcatatattaatgcattgtccttaccaactgagctaa |
4009872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 149 - 196
Target Start/End: Complemental strand, 25979914 - 25979867
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
196 |
Q |
| |
|
|||||| || ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
25979914 |
tggtggccgaggtttgaaccccggaccttgcatacattatgcattgtc |
25979867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 152 - 214
Target Start/End: Complemental strand, 13409617 - 13409555
Alignment:
| Q |
152 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||||||||||||||| | |||||||| ||| |||||||||||| | ||| |||||||||||| |
|
|
| T |
13409617 |
tggtcggggtttgaactccggaccttgtatatattatgcattgttcttatcaactgagctaaa |
13409555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 18331787 - 18331713
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || ||||||| ||||| |||||||| |||||||||||| |||||||||||||||| || |||||||| |
|
|
| T |
18331787 |
tttttttttgtggtggccggggcttgaaccccggaccttgcatattttatgcattgtccataccaagtgagctaa |
18331713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 25603981 - 25604055
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| ||| |||||| |||| || |||||| | |||||||||| |||||||| ||||||||| ||||||||||| |
|
|
| T |
25603981 |
ttttttttgttggtggccgggattcgaaccccgaaccttgcatatattatgcactgtccatatcaactgagctaa |
25604055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 27086158 - 27086084
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || ||||||| |||||||||||||||||||||||||| ||||| |||||| | || ||||||| |||| |
|
|
| T |
27086158 |
tttttttttgtggtggctggggtttgaaccctggaccttgcatatattatacattgttcttacaaactgaactaa |
27086084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 197
Target Start/End: Complemental strand, 32234841 - 32234784
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
32234841 |
ttttttttggtggtggtcggggtttgaaccc-cgaccttgcatattttatgcattgtcc |
32234784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 34191513 - 34191439
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| ||||| |||| |||||||||||||| |||||||||||| ||||||||||||| | ||||||||||| |
|
|
| T |
34191513 |
ttttttttggtagtggccggggtttgaaccccggaccttgcatattttatgcattgtcccaaccaactgagctaa |
34191439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 148 - 198
Target Start/End: Original strand, 37021362 - 37021412
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcca |
198 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||| |||||||||| |||| |
|
|
| T |
37021362 |
gtggtggtcggggtttgaaccctgaatcttgcatatattatgcattatcca |
37021412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 145 - 214
Target Start/End: Complemental strand, 37884737 - 37884670
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||| ||||| |||||||||||||||| |
|
|
| T |
37884737 |
ttggtggtggtcggggtttgaaccctggaccttacatcttttatgtattgt--ttataaactgagctaaa |
37884670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 148 - 209
Target Start/End: Original strand, 8544979 - 8545040
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||||||||| ||| |||| | |||||||||||| |||||||||||||| ||| ||||||| |
|
|
| T |
8544979 |
gtggtggtcggagttcgaactccggaccttgcatatattatgcattgtccttatcaactgag |
8545040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 139 - 200
Target Start/End: Complemental strand, 10531619 - 10531559
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||||| |||||| ||||||||||||||||| |
|
|
| T |
10531619 |
tttttattg-tggtagtcggggtttgaaccacggaccgtgcatatattatgcattgtccata |
10531559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 160 - 213
Target Start/End: Original strand, 10704333 - 10704386
Alignment:
| Q |
160 |
gtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
10704333 |
gtttgaaccccggaccttgcatattttatgcattgtccataccaactgagctaa |
10704386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 148 - 209
Target Start/End: Original strand, 16579364 - 16579425
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||| |||||||||||| |||| ||||||| |
|
|
| T |
16579364 |
gtggtggtcagggtttgaaccacggaccttgcatatattatgcattgttcataccaactgag |
16579425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 140 - 213
Target Start/End: Complemental strand, 20688119 - 20688046
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||| |||||||||| | | |||||||| | |||||||||||| ||||||||||||||| | ||||||||||| |
|
|
| T |
20688119 |
tttttttggtggtggccagagtttgaactccggaccttgcatatattatgcattgtccaaaccaactgagctaa |
20688046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 149 - 214
Target Start/End: Complemental strand, 27903183 - 27903118
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||||||||| |||||||||| | |||||||||| |||||||||||| |||| |||||| ||||| |
|
|
| T |
27903183 |
tggtggtcggagtttgaaccccgaaccttgcatatattatgcattgttcataccaactgaactaaa |
27903118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 148 - 213
Target Start/End: Complemental strand, 40959073 - 40959008
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||| ||||||||||||| ||| || |||||||| |
|
|
| T |
40959073 |
gtggtggtcggggtctgaaccctgaatcttgcatatattatgcattgtcgataccaattgagctaa |
40959008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 148 - 209
Target Start/End: Original strand, 41650930 - 41650990
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||||||||| |||||||| | |||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
41650930 |
gtggtggtcggtgtttgaactc-ggaccttgcatatattatgcattgtccataccaactgag |
41650990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 148 - 197
Target Start/End: Original strand, 42817102 - 42817151
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
|||||||||| ||||||||||| |||||||| ||| |||||||||||||| |
|
|
| T |
42817102 |
gtggtggtcgaggtttgaaccccggaccttgtatatattatgcattgtcc |
42817151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 209
Target Start/End: Original strand, 11637563 - 11637623
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
|||||||||||||| |||||| | |||||||||| |||||||||||||||| ||||||| |
|
|
| T |
11637563 |
tggtggtcggggttcgaaccccgaaccttgcatattttatgcattgtccataccaactgag |
11637623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 145 - 197
Target Start/End: Complemental strand, 11720967 - 11720916
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
|||||||||| |||||||||||||| | |||||||||| |||||||||||||| |
|
|
| T |
11720967 |
ttggtggtggccggggtttgaaccccg-accttgcatatattatgcattgtcc |
11720916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 145 - 209
Target Start/End: Complemental strand, 22555305 - 22555241
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
22555305 |
ttggtggtggtcggggtttgattcccggaccttgcatattatatgcattgtccataccaactgag |
22555241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 145 - 213
Target Start/End: Original strand, 22665190 - 22665258
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| |||||||||||| | ||| |||||||| |||| ||||||||||| ||||||||||| |
|
|
| T |
22665190 |
ttggtggtggccggggtttgaactccggatcttgcatattttatacattgtccatactaactgagctaa |
22665258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 139 - 195
Target Start/End: Complemental strand, 32339815 - 32339759
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
||||| |||||||||| |||| || |||||| |||||||||||| |||||||||||| |
|
|
| T |
32339815 |
ttttttttggtggtggccgggattcgaaccccggaccttgcatatattatgcattgt |
32339759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 137 - 197
Target Start/End: Complemental strand, 37462193 - 37462133
Alignment:
| Q |
137 |
tctttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||||| || ||||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
37462193 |
tctttttttttgtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
37462133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 39914970 - 39914923
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||| |||||||||||||| |
|
|
| T |
39914970 |
tggtggtcggggttcgaaccc-ggaccttgcatatattatgcattgtcc |
39914923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 139 - 214
Target Start/End: Complemental strand, 18147798 - 18147723
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||| || |||||| ||||| |||||||| ||| | |||||| |||||||||||||| ||| |||||||||||| |
|
|
| T |
18147798 |
tttttttttgtggtgaccgggggttgaaccccggatcctgcatatattatgcattgtccttatcaactgagctaaa |
18147723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 146 - 197
Target Start/End: Complemental strand, 31280092 - 31280041
Alignment:
| Q |
146 |
tggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
|||||||||||| ||||||||||| ||| ||||||| |||||||||||||| |
|
|
| T |
31280092 |
tggtggtggtcgaggtttgaaccccggatattgcatatattatgcattgtcc |
31280041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 138 - 213
Target Start/End: Complemental strand, 32858750 - 32858676
Alignment:
| Q |
138 |
ctttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||| |||||||||| ||| ||||||||||| |||||||||| |||||||||||||||| ||| ||||||| |
|
|
| T |
32858750 |
cttttttttggtggtggccggaatttgaaccctg-accttgcatattttatgcattgtccataccaacggagctaa |
32858676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 139 - 214
Target Start/End: Original strand, 37054250 - 37054325
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||| || ||||||||||| |||||||||| | ||||| ||| |||||||||||||| || |||||||||||| |
|
|
| T |
37054250 |
tttttttttgtggtggtcggagtttgaaccccgaaccttatatatattatgcattgtccctaccaactgagctaaa |
37054325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 209
Target Start/End: Complemental strand, 5614844 - 5614775
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||| || |||||||| ||||||||||||| |||||| |||| |||||||||| ||||||| ||||||| |
|
|
| T |
5614844 |
tttttttttgtggtggt-ggggtttgaacccccgaccttacatatattatgcattatccatatcaactgag |
5614775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 9893652 - 9893726
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || ||||||| ||||||||||||| ||||||||||| ||||||||| || |||| ||||||||||| |
|
|
| T |
9893652 |
tttttttttgtggtggctggggtttgaaccccagaccttgcatattttatgcattatctatatcaactgagctaa |
9893726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 209
Target Start/End: Complemental strand, 17708154 - 17708084
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||| || ||||||| | || ||||||| ||| |||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
17708154 |
tttttttttgtggtggccaggatttgaactctgaaccttgcatattttatgcattgtccatatcaactgag |
17708084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 19068421 - 19068494
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || |||||| ||||||||||||||| |||||||||| |||||||||| |||||| ||||||||||| |
|
|
| T |
19068421 |
ttttttttcgtggtgatcggggtttgaacccca-accttgcatatattatgcattatccataccaactgagctaa |
19068494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 197
Target Start/End: Complemental strand, 20125105 - 20125048
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || ||||||||||| |||||||||| | |||||||||| |||||||||||||| |
|
|
| T |
20125105 |
tttttttttgtggtggtcggagtttgaaccc-gaaccttgcatatattatgcattgtcc |
20125048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 22394115 - 22394041
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||| |||||| || ||||||||| ||| ||| |||| |||||||||||||||||| ||||||||||| |
|
|
| T |
22394115 |
tttttatttttggtggcaggagtttgaacctcggatcttacatatattatgcattgtccatatcaactgagctaa |
22394041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 201
Target Start/End: Original strand, 26030432 - 26030494
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatat |
201 |
Q |
| |
|
||||| || ||||||| ||||||| |||||| |||||||||| |||||||||||||||||| |
|
|
| T |
26030432 |
tttttctttgtggtggccggggttcgaaccccggaccttgcaagtattatgcattgtccatat |
26030494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 197
Target Start/End: Complemental strand, 26166807 - 26166761
Alignment:
| Q |
151 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
26166807 |
gtggtcagggtttgaaccctggaccttgcatatttgatgcattgtcc |
26166761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 28207212 - 28207138
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || ||||||| |||| || ||||| |||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
28207212 |
tttttttttgtggtggccgggattcgaacctcggaccttgcatattttatgcattgtccataccaactgagctaa |
28207138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 213
Target Start/End: Original strand, 35270682 - 35270736
Alignment:
| Q |
159 |
ggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| | ||||||||||| |
|
|
| T |
35270682 |
ggtttgaaccctggaccttgcatattttatgcattgtcccaaccaactgagctaa |
35270736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 209
Target Start/End: Original strand, 40837896 - 40837954
Alignment:
| Q |
151 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||| |||||||||| ||||||| |
|
|
| T |
40837896 |
gtggtcggggtttgaaccccggaccttgcatattttatatattgtccataccaactgag |
40837954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 156 - 209
Target Start/End: Complemental strand, 3671281 - 3671228
Alignment:
| Q |
156 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||| ||| ||| ||||||| |
|
|
| T |
3671281 |
cggggttcgaaccctggaccttgcatatattatacattatccttatcaactgag |
3671228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 156 - 213
Target Start/End: Complemental strand, 5846092 - 5846035
Alignment:
| Q |
156 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||||||| ||| ||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
5846092 |
cggggtttgaaccccagactttgcatatattatgcattgtccttaccaactgagctaa |
5846035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 140 - 213
Target Start/End: Complemental strand, 10199098 - 10199025
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||| ||||||||||||||| || |||||| ||||| ||| ||||||||||||||||| ||||||||||| |
|
|
| T |
10199098 |
tttttttggtggtggtcgggattcgaaccccacaccttatatatattatgcattgtccataccaactgagctaa |
10199025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 148 - 213
Target Start/End: Original strand, 11844428 - 11844493
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| | || ||||||| |||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
11844428 |
gtggtggtcgagattcgaaccctaaaccttgcatatattatgcattgtccttaccaactgagctaa |
11844493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 148 - 201
Target Start/End: Complemental strand, 13796401 - 13796348
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatat |
201 |
Q |
| |
|
||||||||||| ||||| |||| ||||||||||| |||||||||||| ||||| |
|
|
| T |
13796401 |
gtggtggtcggagtttgtaccccagaccttgcatatattatgcattgttcatat |
13796348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 160 - 213
Target Start/End: Complemental strand, 16036886 - 16036833
Alignment:
| Q |
160 |
gtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||| ||||||||||||| |||||| ||||||||| ||||||||||| |
|
|
| T |
16036886 |
gtttgaaccatggaccttgcatatattatgtattgtccatgccaactgagctaa |
16036833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 161 - 214
Target Start/End: Complemental strand, 17862037 - 17861984
Alignment:
| Q |
161 |
tttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||||||||| || ||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
17862037 |
tttgaaccctgaactttgcatatattatgcattgtccctaccaactgagctaaa |
17861984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 148 - 213
Target Start/End: Complemental strand, 18391671 - 18391606
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| |||| ||||| |||||||||||| ||||||||||||| || ||||||||||| |
|
|
| T |
18391671 |
gtggtggtcgaggttcgaacctcggaccttgcatattttatgcattgtccttaccaactgagctaa |
18391606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 140 - 209
Target Start/End: Original strand, 18589850 - 18589918
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
|||| ||||||||| ||||| ||| ||||| |||||||||||| |||||||||||| |||| ||||||| |
|
|
| T |
18589850 |
tttttttggtggtgatcggg-tttaaaccccggaccttgcatatattatgcattgttcataccaactgag |
18589918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 139 - 200
Target Start/End: Complemental strand, 18877823 - 18877763
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||| |||||| |||||||| || |||||||||||||| |||| |||||||||||||||| |
|
|
| T |
18877823 |
ttttttttggtgctggtcggg-ttcgaaccctggaccttacatattttatgcattgtccata |
18877763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 139 - 188
Target Start/End: Original strand, 25988803 - 25988852
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattat |
188 |
Q |
| |
|
||||| || ||||||||||| ||||||| ||||||||||||||| ||||| |
|
|
| T |
25988803 |
tttttttttgtggtggtcggagtttgaatcctggaccttgcatatattat |
25988852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 151 - 192
Target Start/End: Complemental strand, 33412159 - 33412118
Alignment:
| Q |
151 |
gtggtcggggtttgaaccctggaccttgcatacattatgcat |
192 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
33412159 |
gtggccggggtttgaatcctggaccttgcatatattatgcat |
33412118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 139 - 196
Target Start/End: Original strand, 35493954 - 35494011
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
196 |
Q |
| |
|
||||| || ||||||||||| ||||||| || | |||||||||| ||||||||||||| |
|
|
| T |
35493954 |
tttttttttgtggtggtcggagtttgaatcccgaaccttgcatatattatgcattgtc |
35494011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 213
Target Start/End: Original strand, 39610359 - 39610396
Alignment:
| Q |
176 |
ttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
39610359 |
ttgcatatattatgcattgtccatatcaactgagctaa |
39610396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 209
Target Start/End: Original strand, 979812 - 979876
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
|||||| ||| ||||||||||||||| ||| ||||||| ||||||||| ||| ||| ||||||| |
|
|
| T |
979812 |
ttggtgttggccggggtttgaaccctagacgttgcatatattatgcatcgtctctatcaactgag |
979876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 213
Target Start/End: Complemental strand, 2839872 - 2839804
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| |||||||| |||||||||| | |||||| ||| |||||||||| |||| | ||||||||||| |
|
|
| T |
2839872 |
ttggtagtggtcggagtttgaaccccgaaccttggatatattatgcattatccaaaccaactgagctaa |
2839804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 193
Target Start/End: Original strand, 5107236 - 5107280
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcatt |
193 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||| |||||||||| |
|
|
| T |
5107236 |
tggtggtcggggttcgaacctcggaccttgcatatattatgcatt |
5107280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 197
Target Start/End: Original strand, 6424902 - 6424942
Alignment:
| Q |
157 |
ggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||||||||||| |
|
|
| T |
6424902 |
ggggtttgaaccccggaccttgtatatattatgcattgtcc |
6424942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 196
Target Start/End: Original strand, 12159391 - 12159439
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
196 |
Q |
| |
|
||||||||||||||||||| |||| ||||| |||| ||||| ||||||| |
|
|
| T |
12159391 |
gtggtggtcggggtttgaatcctgaaccttacatatattatacattgtc |
12159439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 200
Target Start/End: Original strand, 12611025 - 12611077
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
|||||||||| |||| |||||| ||||||||||| |||||||||||||||| |
|
|
| T |
12611025 |
gtggtggtcgaggttcgaaccccagaccttgcatattttatgcattgtccata |
12611077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 213
Target Start/End: Original strand, 14188322 - 14188390
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||||| ||||||||||| ||| ||||||| |||||| |||||||||| |||||| |||| |
|
|
| T |
14188322 |
ttggtggtggtctgggtttgaaccgcggatattgcatatattatggattgtccataccaactgaactaa |
14188390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 150 - 210
Target Start/End: Complemental strand, 16094126 - 16094066
Alignment:
| Q |
150 |
ggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagc |
210 |
Q |
| |
|
|||||||||||||||||||| || ||| |||| |||||||||| ||| ||| |||||||| |
|
|
| T |
16094126 |
ggtggtcggggtttgaaccccagatcttacatatattatgcattatccctatcaactgagc |
16094066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 196
Target Start/End: Original strand, 17151832 - 17151880
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
196 |
Q |
| |
|
||||||||||||||||||| || ||||||||||| ||||| ||||||| |
|
|
| T |
17151832 |
gtggtggtcggggtttgaatccaagaccttgcatatattatacattgtc |
17151880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 140 - 200
Target Start/End: Original strand, 18749157 - 18749217
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
|||| |||||||||| ||| |||| ||||| || || |||||| ||||||||||||||||| |
|
|
| T |
18749157 |
tttttttggtggtggccggagtttaaaccccgggccgtgcatatattatgcattgtccata |
18749217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 140 - 196
Target Start/End: Complemental strand, 27219367 - 27219311
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
196 |
Q |
| |
|
|||| |||| ||||| |||||||||||||||||| ||| |||| |||||| |||||| |
|
|
| T |
27219367 |
tttttttggcggtggccggggtttgaaccctggatcttacatatattatgtattgtc |
27219311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 213
Target Start/End: Complemental strand, 32559378 - 32559310
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| |||| ||||||||| |||||| |||| |||||||||||| |||| || |||||||| |
|
|
| T |
32559378 |
ttggtggtggccgggatttgaaccccagaccttacatattttatgcattgtcaatatcaattgagctaa |
32559310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 195
Target Start/End: Complemental strand, 42473954 - 42473918
Alignment:
| Q |
159 |
ggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
42473954 |
ggtttgaaccccggaccttgcatatattatgcattgt |
42473918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 213
Target Start/End: Complemental strand, 42505918 - 42505878
Alignment:
| Q |
173 |
accttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
42505918 |
accttgcatatattatgcattgtccataccaactgagctaa |
42505878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 51; Significance: 2e-20; HSPs: 133)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 11949744 - 11949818
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || |||||||||||||||||||||| |||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
11949744 |
tttttttttgtggtggtcggggtttgaaccccggaccttgcatatattatgcattgtccataccaactgagctaa |
11949818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 145 - 213
Target Start/End: Complemental strand, 9946501 - 9946433
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
9946501 |
ttggtggtggtcggggtttgaaccccggaccttgcatattttatgcattgtccataccaactgagctaa |
9946433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 149 - 213
Target Start/End: Original strand, 19479468 - 19479532
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||| ||||| ||||||||||| |
|
|
| T |
19479468 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgttcatattaactgagctaa |
19479532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 5924729 - 5924655
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| ||||||||||||| ||||||||||| ||||||| |||| |||||| |||||||||| ||||||||||| |
|
|
| T |
5924729 |
ttttttttggtggtggtcgaggtttgaaccccggaccttccatatattatgtattgtccatagcaactgagctaa |
5924655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 139 - 209
Target Start/End: Complemental strand, 8607207 - 8607137
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||| || ||||| |||||||||||||| | ||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
8607207 |
tttttttttgtggtagtcggggtttgaactccggaccttacatacattatgcattgtccatatcaactgag |
8607137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 19588234 - 19588160
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || ||||||| ||||||||||||||||||||||||||| |||||||||||||||| || |||||||| |
|
|
| T |
19588234 |
tttttttttgtggtggccggggtttgaaccctggaccttgcatattttatgcattgtccataccaattgagctaa |
19588160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 20383568 - 20383494
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || ||||||| ||||||||||||| |||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
20383568 |
tttttttttgtggtggatggggtttgaaccccggaccttgcatatattatgcattgtccataccaactgagctaa |
20383494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 139 - 197
Target Start/End: Original strand, 21318234 - 21318292
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || ||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
21318234 |
ttttttttagtggtggtcggggtttgaaccctagaccttgcatatattatgcattgtcc |
21318292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 24664972 - 24665046
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || ||||||||||||||| |||||| |||||||||||| |||||||||| |||||| ||||||||||| |
|
|
| T |
24664972 |
tttttttttgtggtggtcggggttcgaaccccggaccttgcatatattatgcattctccataccaactgagctaa |
24665046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 139 - 200
Target Start/End: Complemental strand, 16470384 - 16470323
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||| || ||||||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
16470384 |
tttttttttgtggtggtcggggttcgaaccctggaccttgcatattttatgcattgtccata |
16470323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 139 - 200
Target Start/End: Original strand, 21114286 - 21114347
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||| || |||||||||||||||||||||| |||||||||||| || |||||||||||||| |
|
|
| T |
21114286 |
tttttttttgtggtggtcggggtttgaaccccggaccttgcatatatcatgcattgtccata |
21114347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 148 - 213
Target Start/End: Complemental strand, 23810020 - 23809955
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||| ||||||| ||||||||| ||||||||||| |
|
|
| T |
23810020 |
gtggtggccggggtttgaaccctgaaccttgcatatattatgctttgtccataccaactgagctaa |
23809955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 145 - 214
Target Start/End: Original strand, 28435235 - 28435304
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||||||||| ||||||||||||| | |||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
28435235 |
ttggtggtggctggggtttgaaccccgaaccttgcatatattatgcattgtccataccaactgagctaaa |
28435304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 139 - 200
Target Start/End: Complemental strand, 36490648 - 36490587
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||| || |||||||||||| ||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
36490648 |
tttttttttgtggtggtcgggatttgaaccccggatcttgcatacattatgcattgtccata |
36490587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 140 - 213
Target Start/End: Complemental strand, 38453344 - 38453271
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||| |||||||||| |||||| ||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
38453344 |
tttttttggtggtggctggggttcgaaccctggaccttgcatatattatgcattgtccatgccaactgagctaa |
38453271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 214
Target Start/End: Complemental strand, 22040711 - 22040655
Alignment:
| Q |
158 |
gggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||||||||||| | |||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
22040711 |
gggtttgaaccccgaaccttgcatatattatgcattgtccatatcaactgagctaaa |
22040655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 139 - 214
Target Start/End: Complemental strand, 11198408 - 11198333
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||| || ||||||| |||||||||||||| |||||||||||| ||||||| |||||||| |||||||||||| |
|
|
| T |
11198408 |
tttttttttgtggtggccggggtttgaaccccggaccttgcatatattatgccttgtccattctaactgagctaaa |
11198333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 158 - 213
Target Start/End: Original strand, 39171370 - 39171425
Alignment:
| Q |
158 |
gggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
39171370 |
gggtttgaaccctgaaccttgcatattttatgcattgtccatatcaactgagctaa |
39171425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 139 - 206
Target Start/End: Original strand, 49041962 - 49042029
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaact |
206 |
Q |
| |
|
||||| || ||||||| |||||||||||||| |||||||||||| ||||||||||||| |||| |||| |
|
|
| T |
49041962 |
tttttttttgtggtggccggggtttgaaccccggaccttgcatatattatgcattgtctatatcaact |
49042029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 3936707 - 3936633
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || ||||||| ||||||| |||||| |||||||||||| |||||||||||| |||| ||||||||||| |
|
|
| T |
3936707 |
tttttttttgtggtggccggggttcgaaccccggaccttgcatatattatgcattgttcataccaactgagctaa |
3936633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 20799375 - 20799449
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| ||||||||| | |||||||||||| |||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
20799375 |
ttttttttggtggtgaccagggtttgaaccccggaccttgcatatattatgcattgtccctaccaactgagctaa |
20799449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 139 - 197
Target Start/End: Complemental strand, 23775598 - 23775540
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || |||||||| |||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
23775598 |
tttttttttgtggtggttggggttcgaaccctggaccttgcatatattatgcattgtcc |
23775540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 139 - 209
Target Start/End: Original strand, 43034323 - 43034393
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||| |||||||||| ||||||||||||| ||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
43034323 |
ttttttttggtggtggccggggtttgaacctcagaccttgcatatattatgcattgtccataccaactgag |
43034393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 151 - 213
Target Start/End: Original strand, 43374265 - 43374327
Alignment:
| Q |
151 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||||||||| | | |||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
43374265 |
gtggtcggggtttgaactccgaaccttgcatattttatgcattgtccatatcaactgagctaa |
43374327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 159 - 213
Target Start/End: Original strand, 50362140 - 50362194
Alignment:
| Q |
159 |
ggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
50362140 |
ggtttgaaccctggaccttgcatatattatgcattgtccctaccaactgagctaa |
50362194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 53190375 - 53190301
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| ||| |||||| |||| || ||||||||||||||||||| |||||||||| |||||| ||||||||||| |
|
|
| T |
53190375 |
ttttttttgatggtgggcgggattcgaaccctggaccttgcatatattatgcattatccataccaactgagctaa |
53190301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 56551573 - 56551647
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || ||||||| ||||||||||||| |||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
56551573 |
tttttttttgtggtggccggggtttgaacctcggaccttgcatatattatgcattgtccttaccaactgagctaa |
56551647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 56564964 - 56565038
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || |||||| |||||||| ||||||| ||||||||||| ||||||||||||||||| || |||||||| |
|
|
| T |
56564964 |
tttttttttgtggtgttcggggttcgaaccctagaccttgcatattttatgcattgtccatatcaattgagctaa |
56565038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 148 - 213
Target Start/End: Complemental strand, 7230351 - 7230286
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||| || ||||||||||| |||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
7230351 |
gtggtggccgaggtttgaaccccggaccttgcatatattatgcattgtccttaccaactgagctaa |
7230286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 149 - 214
Target Start/End: Original strand, 16304089 - 16304154
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||||| || |||||||| || |||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
16304089 |
tggtggccgcggtttgaatcccggaccttgcatatattatgcattgtccataccaactgagctaaa |
16304154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 152 - 209
Target Start/End: Complemental strand, 25115116 - 25115059
Alignment:
| Q |
152 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||||| ||||||| |
|
|
| T |
25115116 |
tggtcggggtttgaaccctgaaccttgcatatgttatgcattgtccataccaactgag |
25115059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 140 - 213
Target Start/End: Complemental strand, 31760325 - 31760252
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||| ||||||||||| || |||||||| |||||||||||||| ||||| ||||||| ||| ||||||||||| |
|
|
| T |
31760325 |
tttttttggtggtggttggagtttgaactctggaccttgcatatattatacattgtctataccaactgagctaa |
31760252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 213
Target Start/End: Complemental strand, 675980 - 675924
Alignment:
| Q |
157 |
ggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||||| | ||||||||||| |
|
|
| T |
675980 |
ggggtttgaaccccggaccttgcatatattatgcattgtccaaaccaactgagctaa |
675924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 145 - 213
Target Start/End: Original strand, 836222 - 836290
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||| ||| |||||||||| || ||||||||||| |
|
|
| T |
836222 |
ttggtggtggtcggagtttgaacctcggaccttgcatatattttgcattgtccctaccaactgagctaa |
836290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 145 - 209
Target Start/End: Original strand, 14202466 - 14202530
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||| |||| |||||||||| |||| || ||||||| |
|
|
| T |
14202466 |
ttggtagtggtcggggtttgaaccccggaccttacatatattatgcattatccaaatcaactgag |
14202530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 139 - 214
Target Start/End: Original strand, 8027378 - 8027453
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||| || |||||||||||||||||||||| || |||||||| |||||||||| ||| || |||||||||||| |
|
|
| T |
8027378 |
tttttttttgtggtggtcggggtttgaacccccgatcttgcatatattatgcattatccttaccaactgagctaaa |
8027453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 139 - 194
Target Start/End: Original strand, 30850365 - 30850420
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattg |
194 |
Q |
| |
|
||||| || |||| ||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
30850365 |
tttttttttgtggaggtcggggtttgaaccctgaaccttgcatatattatgcattg |
30850420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 139 - 214
Target Start/End: Complemental strand, 37921826 - 37921751
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||| || ||||| | ||||||||||| || |||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
37921826 |
tttttttttgtggtagccggggtttgaatcccggaccttgcatatattatgcattgtccttactaactgagctaaa |
37921751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 140 - 195
Target Start/End: Original strand, 54857597 - 54857652
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
|||| |||||||||| |||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
54857597 |
tttttttggtggtggccggggtttgaaccccggaccttgcatattttatgcattgt |
54857652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 6087827 - 6087753
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||| |||||| ||||||||||||| ||||||||||| |||||||||| || ||| ||||||||||| |
|
|
| T |
6087827 |
tttttattgatggtggctggggtttgaaccccagaccttgcatatattatgcattatctataccaactgagctaa |
6087753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 16431696 - 16431622
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || |||| || |||||||||||||| ||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
16431696 |
tttttttttgtggaggccggggtttgaaccccagaccttgcatattttatgcattgtccataccaactgagctaa |
16431622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 17729506 - 17729432
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || |||||||||||||||||||||| ||||||||||| |||||||| || |||| ||||||||||| |
|
|
| T |
17729506 |
tttttttttgtggtggtcggggtttgaaccccagaccttgcatatattatgcaaggttcataccaactgagctaa |
17729432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 197
Target Start/End: Complemental strand, 19908772 - 19908714
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || ||||||||||||||| ||||| |||||||||||| |||||||||||||| |
|
|
| T |
19908772 |
tttttttttgtggtggtcggggttcgaacctcggaccttgcatatattatgcattgtcc |
19908714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 23303997 - 23304071
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| |||||||||| ||||||| | |||| |||||||||||| ||||||| |||||| || ||||||||||| |
|
|
| T |
23303997 |
ttttttttggtggtggccggggttcgcaccccggaccttgcatatattatgccttgtccctaccaactgagctaa |
23304071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 197
Target Start/End: Original strand, 24079821 - 24079879
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || |||||||||||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
24079821 |
tttttttttgtggtggtcggggtttgaactccggaccttgcatattttatgcattgtcc |
24079879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 151 - 213
Target Start/End: Original strand, 35021460 - 35021522
Alignment:
| Q |
151 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||||| |||||| | |||||||||| ||||| ||||||||||| ||||||||||| |
|
|
| T |
35021460 |
gtggtcggggttcgaaccccgaaccttgcatattttatgtattgtccatatcaactgagctaa |
35021522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 35287488 - 35287562
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || ||||||| ||||||| |||||| |||||||||||| ||||||||||| |||| ||||||||||| |
|
|
| T |
35287488 |
tttttttttgtggtggccggggttggaaccccggaccttgcatattttatgcattgttcataccaactgagctaa |
35287562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 197
Target Start/End: Original strand, 47806237 - 47806295
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| ||||||||| |||||||| |||||| ||||||||||| |||||||||||||| |
|
|
| T |
47806237 |
ttttttttggtggtgttcggggttcgaaccccagaccttgcatatattatgcattgtcc |
47806295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 151 - 213
Target Start/End: Original strand, 47814244 - 47814306
Alignment:
| Q |
151 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||| |||||||||||||| |||||||||||| |||||| ||||||||| ||||||||||| |
|
|
| T |
47814244 |
gtggccggggtttgaaccccggaccttgcatatattatgtgttgtccataccaactgagctaa |
47814306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 214
Target Start/End: Complemental strand, 897487 - 897430
Alignment:
| Q |
157 |
ggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||||||||||| ||||||| |||| ||||| ||||||||||| |||||||||||| |
|
|
| T |
897487 |
ggggtttgaaccccggaccttacatatattatacattgtccataccaactgagctaaa |
897430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 139 - 196
Target Start/End: Original strand, 10336967 - 10337024
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
196 |
Q |
| |
|
||||| || |||||| ||||||||||||||| | ||||| |||||||||||||||||| |
|
|
| T |
10336967 |
tttttttttgtggtgttcggggtttgaaccccgaaccttacatacattatgcattgtc |
10337024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 145 - 194
Target Start/End: Complemental strand, 34042314 - 34042265
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattg |
194 |
Q |
| |
|
||||||||||||| ||||||||||| | |||||||||| ||||||||||| |
|
|
| T |
34042314 |
ttggtggtggtcgaggtttgaaccccgaaccttgcatatattatgcattg |
34042265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 160 - 213
Target Start/End: Complemental strand, 37193308 - 37193255
Alignment:
| Q |
160 |
gtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| |||||||||||| ||||| ||||||||||| ||||||||||| |
|
|
| T |
37193308 |
gtttgaaccccggaccttgcatatattatacattgtccatactaactgagctaa |
37193255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 148 - 197
Target Start/End: Complemental strand, 42845096 - 42845047
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||||||||| |||| ||||| |||||||||||| |||||||||||||| |
|
|
| T |
42845096 |
gtggtggtcggagttttaaccccggaccttgcatatattatgcattgtcc |
42845047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 160 - 201
Target Start/End: Original strand, 49953405 - 49953446
Alignment:
| Q |
160 |
gtttgaaccctggaccttgcatacattatgcattgtccatat |
201 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
49953405 |
gtttgaaccccggaccttgcatatattatgcattgtccatat |
49953446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 148 - 200
Target Start/End: Original strand, 8415485 - 8415537
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||||||| ||||||||||| |||| ||| |||| ||||||||||||||||| |
|
|
| T |
8415485 |
gtggtggtcagggtttgaaccttggatcttacatatattatgcattgtccata |
8415537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 145 - 209
Target Start/End: Complemental strand, 10148253 - 10148189
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||| |||| || ||||||||| ||| |||||||||| ||||||||||||||| || ||||||| |
|
|
| T |
10148253 |
ttggtagtggccgaggtttgaactctgaaccttgcatatattatgcattgtccaaatcaactgag |
10148189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 148 - 192
Target Start/End: Complemental strand, 18094476 - 18094432
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcat |
192 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
18094476 |
gtggtggttagggtttgaaccctggaccttgcatatattatgcat |
18094432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 145 - 213
Target Start/End: Original strand, 21317325 - 21317393
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||| | ||||||||||| ||||||||||| ||||||||||||| || ||||||||||| |
|
|
| T |
21317325 |
ttggtggtggttgaggtttgaacccctgaccttgcatatattatgcattgtctctaccaactgagctaa |
21317393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 139 - 195
Target Start/End: Original strand, 22164250 - 22164306
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
||||| ||| ||||||||||||||||||||| |||||| |||| |||||||||||| |
|
|
| T |
22164250 |
ttttttttgttggtggtcggggtttgaaccccagaccttacatatattatgcattgt |
22164306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 139 - 195
Target Start/End: Original strand, 37930828 - 37930884
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
||||| || ||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
37930828 |
tttttttttgtggtggtcggggtttgaacctcagaccttgcatatattatgcattgt |
37930884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 214
Target Start/End: Complemental strand, 43722826 - 43722770
Alignment:
| Q |
158 |
gggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||||||||||| ||||||| |||| ||||||||||||||||| ||||||| |||| |
|
|
| T |
43722826 |
gggtttgaaccccggaccttacatatattatgcattgtccataccaactgagttaaa |
43722770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 213
Target Start/End: Original strand, 47015559 - 47015623
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| |||||||||| ||||||| ||| ||||||||||||||||| |||||| |||| |
|
|
| T |
47015559 |
tggtggtcggagtttgaaccccagaccttgtatatattatgcattgtccatactaactgaactaa |
47015623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 145 - 197
Target Start/End: Complemental strand, 55061111 - 55061059
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
55061111 |
ttggtggtggtcggaatttgaacccccgaccttgcatatattatgcattgtcc |
55061059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 213
Target Start/End: Original strand, 55421560 - 55421624
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||| || | ||||||||| |||||||||| ||||||||||||||| | ||||||||||| |
|
|
| T |
55421560 |
tggtggtcaggatctgaaccctgaaccttgcatatattatgcattgtccaaaccaactgagctaa |
55421624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 139 - 214
Target Start/End: Original strand, 12671729 - 12671804
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||| || |||||||||| |||| |||||| ||| |||||||| |||||||||||| ||| |||||||||||| |
|
|
| T |
12671729 |
tttttttttgtggtggtcgaggttcgaaccccggatcttgcatattttatgcattgtctataccaactgagctaaa |
12671804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 140 - 195
Target Start/End: Original strand, 21449881 - 21449935
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
|||| |||||||||| |||| |||||||||||||||||||||| || ||||||||| |
|
|
| T |
21449881 |
tttttttggtggtggccggg-tttgaaccctggaccttgcatatatcatgcattgt |
21449935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 149 - 196
Target Start/End: Original strand, 22630351 - 22630398
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
196 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
22630351 |
tggtggtcggggtttgaacctcagaccttgcatatattatgcattgtc |
22630398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 145 - 200
Target Start/End: Complemental strand, 33495639 - 33495584
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||||||||| ||||||||||||||| | |||||||| |||||| ||||| |||| |
|
|
| T |
33495639 |
ttggtggtggttggggtttgaaccctgaatcttgcatatattatgtattgttcata |
33495584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 139 - 206
Target Start/End: Original strand, 34969374 - 34969441
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaact |
206 |
Q |
| |
|
||||| || ||||||||||| |||||||||||| |||||||||| ||||| ||||| ||||| |||| |
|
|
| T |
34969374 |
tttttttttgtggtggtcggagtttgaaccctgaaccttgcatatattatatattgttcatatcaact |
34969441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 139 - 214
Target Start/End: Original strand, 39093556 - 39093631
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||| || ||||| ||||||||||||||||| || ||||||| |||||||||||||| || || ||||||||| |
|
|
| T |
39093556 |
tttttttttgtggtagtcggggtttgaaccctaaactttgcatatattatgcattgtccttaccaattgagctaaa |
39093631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 149 - 196
Target Start/End: Complemental strand, 41521024 - 41520977
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
196 |
Q |
| |
|
|||||||||| ||||||||| || |||||||||| ||||||||||||| |
|
|
| T |
41521024 |
tggtggtcggagtttgaaccttgaaccttgcatatattatgcattgtc |
41520977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 139 - 214
Target Start/End: Complemental strand, 47266232 - 47266157
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||| || ||||||||||||||||||| ||| |||||| |||| ||||| ||||||| ||| |||||| ||||| |
|
|
| T |
47266232 |
tttttttttgtggtggtcggggtttgaatcctagaccttacatatattatacattgtctataccaactgatctaaa |
47266157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 213
Target Start/End: Complemental strand, 281651 - 281597
Alignment:
| Q |
159 |
ggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||| ||||||| |||| ||||||||||||||||| ||||| ||||| |
|
|
| T |
281651 |
ggtttgaaccccggacctttcatatattatgcattgtccataccaactgcgctaa |
281597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 209
Target Start/End: Original strand, 7371529 - 7371599
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||| ||| ||||| ||||||| |||||| |||||||||||| |||||| ||||||| ||| ||||||| |
|
|
| T |
7371529 |
ttttttttgttggtgtccggggttcgaaccccggaccttgcatatattatgtattgtccttatcaactgag |
7371599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 8495067 - 8494993
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || ||||||| |||| ||||||| | ||| |||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
8495067 |
tttttttttgtggtggccgggatttgaactcgggatcttgcatatattatgcattgtccctaccaactgagctaa |
8494993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 145 - 211
Target Start/End: Complemental strand, 9783973 - 9783907
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagct |
211 |
Q |
| |
|
|||||||||| || |||||||||| |||||| |||| |||||||||||||||||| |||| |||| |
|
|
| T |
9783973 |
ttggtggtggccgaggtttgaacctcagaccttacatatattatgcattgtccatatcaactaagct |
9783907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 197
Target Start/End: Original strand, 10261750 - 10261808
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || ||||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
10261750 |
tttttttttgtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
10261808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 10401377 - 10401451
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| ||| |||||||| || |||||||||||||||||||||| |||||||||| |||| |||||| |||| |
|
|
| T |
10401377 |
ttttttttgttggtggtcaggatttgaaccctggaccttgcatattgtatgcattgttcataccaactgaactaa |
10401451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 213
Target Start/End: Complemental strand, 12322733 - 12322679
Alignment:
| Q |
159 |
ggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||| ||| |||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
12322733 |
ggtttgaaccccggaacttgcatatattatgcattgtccgtaccaactgagctaa |
12322679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 156 - 214
Target Start/End: Original strand, 14577505 - 14577563
Alignment:
| Q |
156 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||||||||||| | |||| ||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
14577505 |
cggggtttgaactccggactttgcatatattatgcattgtccttaccaactgagctaaa |
14577563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 213
Target Start/End: Complemental strand, 19854625 - 19854571
Alignment:
| Q |
159 |
ggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||| |||||| ||| |||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
19854625 |
ggttcgaaccccggatcttgcatatattatgcattgtccataccaactgagctaa |
19854571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 197
Target Start/End: Complemental strand, 21562705 - 21562647
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || ||||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
21562705 |
tttttttttgtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
21562647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 23247579 - 23247653
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || ||||||| |||||||| ||||| ||||||||||| ||||||| ||||||||| ||| ||||||| |
|
|
| T |
23247579 |
tttttttttgtggtggccggggtttaaaccccagaccttgcatatattatgcgttgtccataccaaccgagctaa |
23247653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 197
Target Start/End: Original strand, 26926691 - 26926749
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || ||||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
26926691 |
tttttttttgtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
26926749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 197
Target Start/End: Complemental strand, 29908136 - 29908078
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || |||||| ||| ||||||||| | |||||||||||| |||||||||||||| |
|
|
| T |
29908136 |
tttttttttgtggtgatcgaggtttgaactccggaccttgcatatattatgcattgtcc |
29908078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 32180910 - 32180836
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || ||||||||||||||| |||||| ||| ||||||| |||||||||||| ||| ||||||||||| |
|
|
| T |
32180910 |
tttttttttgtggtggtcggggttcgaaccccagactttgcatattttatgcattgtctataccaactgagctaa |
32180836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 214
Target Start/End: Complemental strand, 34247491 - 34247445
Alignment:
| Q |
168 |
cctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
34247491 |
cctggaccttgcatatattatgcattgtccttaccaactgagctaaa |
34247445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 171 - 213
Target Start/End: Complemental strand, 36203284 - 36203242
Alignment:
| Q |
171 |
ggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
36203284 |
ggaccttgcatatattatgcattgtccttatcaactgagctaa |
36203242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 37725702 - 37725776
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| ||||| ||||||||||||| ||||| | |||||||||| |||| |||||||| | |||||||||||| |
|
|
| T |
37725702 |
ttttttttggtagtggtcggggtttaaaccccgaaccttgcatattttatacattgtcccaacaaactgagctaa |
37725776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 197
Target Start/End: Complemental strand, 38375037 - 38374979
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || ||||||| |||||||||||| | ||||||||||| |||||||||||||| |
|
|
| T |
38375037 |
tttttttttgtggtggccggggtttgaactccagaccttgcatatattatgcattgtcc |
38374979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 209
Target Start/End: Original strand, 40070949 - 40071019
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||| || ||| |||||||||||||||| |||||||||||| |||||||||||| |||| ||||||| |
|
|
| T |
40070949 |
tttttttttgtgatggtcggggtttgaacttcggaccttgcatatattatgcattgttcataccaactgag |
40071019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 150 - 200
Target Start/End: Complemental strand, 42139913 - 42139863
Alignment:
| Q |
150 |
ggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||| |||||||||||||| |||| |||||| ||||||||||||||||| |
|
|
| T |
42139913 |
ggtggccggggtttgaaccccggacattgcatgtattatgcattgtccata |
42139863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 197
Target Start/End: Complemental strand, 43330226 - 43330168
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || ||||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
43330226 |
tttttttttgtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
43330168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 197
Target Start/End: Complemental strand, 51450292 - 51450234
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || ||||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
51450292 |
tttttttttgtggtggccggggtttgaactccggaccttgcatatcttatgcattgtcc |
51450234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 147 - 193
Target Start/End: Original strand, 54294411 - 54294457
Alignment:
| Q |
147 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcatt |
193 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
54294411 |
ggtggtgtccggggtttgaaccccggaccttgcatatattatgcatt |
54294457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 54500649 - 54500575
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || ||||||||| | |||||||||| ||||||| |||| ||||||||||||| || ||||||||||| |
|
|
| T |
54500649 |
tttttttttgtggtggtcagtgtttgaaccccggaccttacatatattatgcattgtctctaccaactgagctaa |
54500575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 172 - 213
Target Start/End: Original strand, 2186347 - 2186388
Alignment:
| Q |
172 |
gaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
2186347 |
gaccttgcatatattatgcattgtccataccaactgagctaa |
2186388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 151 - 200
Target Start/End: Complemental strand, 6610331 - 6610282
Alignment:
| Q |
151 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||| |||| |||||| |
|
|
| T |
6610331 |
gtggtcggggtttgaaccccagaccttgcatatattatacattatccata |
6610282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 9196267 - 9196226
Alignment:
| Q |
165 |
aaccctggaccttgcatacattatgcattgtccatataaact |
206 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||| |||| |
|
|
| T |
9196267 |
aaccctggacctggcatatattatgcattgtccatatcaact |
9196226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 157 - 214
Target Start/End: Complemental strand, 9392995 - 9392938
Alignment:
| Q |
157 |
ggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||||||||||||||| ||| |||| || ||||||||||| ||| ||||||| |||| |
|
|
| T |
9392995 |
ggggtttgaaccctggatcttacatatataatgcattgtccttattaactgagttaaa |
9392938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 172 - 213
Target Start/End: Complemental strand, 12698644 - 12698603
Alignment:
| Q |
172 |
gaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||| ||||||||||||||| || ||||||||||| |
|
|
| T |
12698644 |
gaccttgcatatattatgcattgtccaaatcaactgagctaa |
12698603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 149 - 214
Target Start/End: Original strand, 18915037 - 18915102
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||||||||| || |||||| ||||| || ||| |||||||||||||| || |||||||||||| |
|
|
| T |
18915037 |
tggtggtcgggattcgaaccccggaccatgaatatattatgcattgtccttaccaactgagctaaa |
18915102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 174 - 215
Target Start/End: Original strand, 19347335 - 19347376
Alignment:
| Q |
174 |
ccttgcatacattatgcattgtccatataaactgagctaaag |
215 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
19347335 |
ccttgcatattttatgcattgtccatatcaactgagctaaag |
19347376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 139 - 196
Target Start/End: Original strand, 19997345 - 19997402
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
196 |
Q |
| |
|
||||| || ||||||||||| |||||||||| | || ||||||| ||||||||||||| |
|
|
| T |
19997345 |
tttttttttgtggtggtcggagtttgaaccccgaactttgcatatattatgcattgtc |
19997402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 160 - 197
Target Start/End: Original strand, 25783451 - 25783488
Alignment:
| Q |
160 |
gtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
25783451 |
gtttgaaccccggaccttgcatatattatgcattgtcc |
25783488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 26033335 - 26033286
Alignment:
| Q |
159 |
ggtttgaaccctggaccttgcatacattatgcattgtccatataaactga |
208 |
Q |
| |
|
||||| ||||||| | |||||||| |||||||||||||||||| |||||| |
|
|
| T |
26033335 |
ggtttaaaccctgaagcttgcatatattatgcattgtccatatcaactga |
26033286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 152 - 213
Target Start/End: Complemental strand, 43155146 - 43155085
Alignment:
| Q |
152 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||||||||| || |||||||| |||||||||| |||||| ||||||||||| |
|
|
| T |
43155146 |
tggtcggggtttgaacctcagatcttgcatatattatgcattatccataacaactgagctaa |
43155085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 139 - 200
Target Start/End: Complemental strand, 43499671 - 43499610
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||| || ||||||| |||||||||||||| |||||||| ||| |||| ||||||||||| |
|
|
| T |
43499671 |
tttttttttgtggtggccggggtttgaaccccggaccttgtatattttatacattgtccata |
43499610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 156 - 193
Target Start/End: Complemental strand, 44816004 - 44815967
Alignment:
| Q |
156 |
cggggtttgaaccctggaccttgcatacattatgcatt |
193 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
44816004 |
cggggtttgaaccccggaccttgcatatattatgcatt |
44815967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 164 - 213
Target Start/End: Original strand, 46676504 - 46676553
Alignment:
| Q |
164 |
gaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
46676504 |
gaaccccggaccttgcatatattatgcattgtccttaccaactgagctaa |
46676553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 139 - 196
Target Start/End: Complemental strand, 48171961 - 48171904
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
196 |
Q |
| |
|
||||| || ||||||||||||||||||||| | |||||||||| ||||| ||||||| |
|
|
| T |
48171961 |
tttttttttgtggtggtcggggtttgaacctagaaccttgcatatattatacattgtc |
48171904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 149 - 214
Target Start/End: Complemental strand, 49021836 - 49021771
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||||||||||||| ||| ||| ||||||||||| ||||| |||||||||| ||||| |||||| |
|
|
| T |
49021836 |
tggtggtcggggttcgaatcctagaccttgcatattttatgtattgtccataccaactgcgctaaa |
49021771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 172 - 213
Target Start/End: Original strand, 52270044 - 52270085
Alignment:
| Q |
172 |
gaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
52270044 |
gaccttgcatatattatgcattgtccataccaactgagctaa |
52270085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 140 - 197
Target Start/End: Original strand, 56497590 - 56497647
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
|||| |||||||||| |||| || |||||| ||||||||||| |||||||||||||| |
|
|
| T |
56497590 |
tttttttggtggtggccgggattcgaaccccagaccttgcatatattatgcattgtcc |
56497647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 158 - 214
Target Start/End: Original strand, 2649733 - 2649789
Alignment:
| Q |
158 |
gggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||| |||| | |||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
2649733 |
gggttcgaactccggaccttgcatatattatgcattgtccctaccaactgagctaaa |
2649789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 158 - 214
Target Start/End: Complemental strand, 7248397 - 7248341
Alignment:
| Q |
158 |
gggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||||| || ||||||| |||| |
|
|
| T |
7248397 |
gggtttgaaccctagaccttgcatattttatgcattgtcccaatcaactgagttaaa |
7248341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 213
Target Start/End: Complemental strand, 12439710 - 12439670
Alignment:
| Q |
173 |
accttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
12439710 |
accttgcatatattatgcattgtccttatcaactgagctaa |
12439670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 197
Target Start/End: Original strand, 14542747 - 14542799
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||||||| || ||||| |||||| ||||||||||| |||||||||||||| |
|
|
| T |
14542747 |
ttggtggtgttcagggttcgaaccccagaccttgcatatattatgcattgtcc |
14542799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 197
Target Start/End: Complemental strand, 15988491 - 15988439
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||||||||||| |||| |||||| |||||||| ||| | |||||||||||| |
|
|
| T |
15988491 |
ttggtggtggtcgaggttcgaaccccggaccttgtatatagtatgcattgtcc |
15988439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 160 - 196
Target Start/End: Original strand, 17423179 - 17423215
Alignment:
| Q |
160 |
gtttgaaccctggaccttgcatacattatgcattgtc |
196 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
17423179 |
gtttgaaccccggaccttgcatatattatgcattgtc |
17423215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 214
Target Start/End: Original strand, 19935169 - 19935217
Alignment:
| Q |
166 |
accctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||| ||||||||||| |||||||||||| | ||| |||||||||||| |
|
|
| T |
19935169 |
accctcgaccttgcatagattatgcattgttcttatcaactgagctaaa |
19935217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 160 - 212
Target Start/End: Complemental strand, 22411823 - 22411771
Alignment:
| Q |
160 |
gtttgaaccctggaccttgcatacattatgcattgtccatataaactgagcta |
212 |
Q |
| |
|
|||||||||| | ||||| |||| ||||||||||||||||| |||||||||| |
|
|
| T |
22411823 |
gtttgaaccccgaaccttacatatattatgcattgtccataccaactgagcta |
22411771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 156 - 200
Target Start/End: Original strand, 31138991 - 31139035
Alignment:
| Q |
156 |
cggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
31138991 |
cggggtttgaacctcggaccttgcatattttatgcattgtccata |
31139035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 213
Target Start/End: Complemental strand, 36035900 - 36035840
Alignment:
| Q |
153 |
ggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||| |||||||||| |||||||| ||| |||||||||| |||| | ||||||||||| |
|
|
| T |
36035900 |
ggtcggagtttgaaccccggaccttggatatattatgcattatccaaactaactgagctaa |
36035840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 139 - 199
Target Start/End: Complemental strand, 37462190 - 37462131
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccat |
199 |
Q |
| |
|
||||| || ||||||||||||||| ||| || ||||||| |||| |||||||||||||||| |
|
|
| T |
37462190 |
tttttttttgtggtggtcggggttggaatcc-ggaccttacatatattatgcattgtccat |
37462131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 213
Target Start/End: Original strand, 42756121 - 42756161
Alignment:
| Q |
173 |
accttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
42756121 |
accttgcatatattatgcattgtccttatcaactgagctaa |
42756161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 213
Target Start/End: Original strand, 43782296 - 43782360
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||| |||||||||| ||||||||||| ||||||||||||| || ||||||||||| |
|
|
| T |
43782296 |
tggtggtcgaggtttgaaccgcagaccttgcatatattatgcattgtcattaccaactgagctaa |
43782360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 209
Target Start/End: Complemental strand, 44724457 - 44724393
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
|||||||||||| ||| ||||||||| |||| |||||||| ||||||||| |||| ||||||| |
|
|
| T |
44724457 |
ttggtggtggtcaggggttgaaccctatacctcgcatacatcatgcattgttcataccaactgag |
44724393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 150 - 206
Target Start/End: Complemental strand, 48159746 - 48159690
Alignment:
| Q |
150 |
ggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaact |
206 |
Q |
| |
|
|||||||||| ||||||| | ||||| |||| ||||||||||||||||||||||| |
|
|
| T |
48159746 |
ggtggtcgggatttgaacttcgaaccttacatatattatgcattgtccatataaact |
48159690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 197
Target Start/End: Original strand, 48694649 - 48694689
Alignment:
| Q |
157 |
ggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| ||||| |
|
|
| T |
48694649 |
ggggtttgaactctggaccttgcatatattatgcactgtcc |
48694689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 197
Target Start/End: Complemental strand, 49473707 - 49473667
Alignment:
| Q |
157 |
ggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
|||||| |||||| |||||||||||| |||||||||||||| |
|
|
| T |
49473707 |
ggggttcgaaccccggaccttgcatatattatgcattgtcc |
49473667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 152 - 200
Target Start/End: Complemental strand, 50656665 - 50656617
Alignment:
| Q |
152 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||| ||||| ||||||| ||||||||||| |||| |||||||||||| |
|
|
| T |
50656665 |
tggtcagggttcgaaccctagaccttgcatatattaagcattgtccata |
50656617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 51; Significance: 2e-20; HSPs: 122)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 151 - 213
Target Start/End: Original strand, 8781643 - 8781705
Alignment:
| Q |
151 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8781643 |
gtggtcggggtttgaaccccggaccttgcatacattatgcattgtccataccaactgagctaa |
8781705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 149 - 200
Target Start/End: Original strand, 660813 - 660864
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
660813 |
tggtggtcggggtttgaaccctggaccttgcatatattatgcattgtccata |
660864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 139 - 214
Target Start/End: Original strand, 25186223 - 25186298
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||| || ||||||| ||||||||||||| |||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
25186223 |
tttttttttgtggtggctggggtttgaaccccggaccttgcatatattatgcattgtccatatcaactgagctaaa |
25186298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 152 - 214
Target Start/End: Complemental strand, 29734758 - 29734696
Alignment:
| Q |
152 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
29734758 |
tggtcggggtttgaaccacggaccttgcatatattatgcattgtccatatcaactgagctaaa |
29734696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 146 - 209
Target Start/End: Original strand, 9547397 - 9547460
Alignment:
| Q |
146 |
tggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
9547397 |
tggtggtggtcggggtttgaaccccaaaccttgcatatattatgcattgtccatatcaactgag |
9547460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 148 - 195
Target Start/End: Original strand, 23250310 - 23250357
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23250310 |
gtggtggtcggggtttgaaccctggaccttgcatatattatgcattgt |
23250357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 10735812 - 10735886
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| |||||||||| |||||||||||||| |||||||||||| ||||||||| |||| || ||||||||||| |
|
|
| T |
10735812 |
ttttttttggtggtggccggggtttgaaccccggaccttgcatatattatgcatcgtccctaccaactgagctaa |
10735886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 20565056 - 20565130
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || |||||||| ||||||||||||| |||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
20565056 |
tttttttttgtggtggttggggtttgaaccccggaccttgcatatattatgcattgtccctaccaactgagctaa |
20565130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 139 - 209
Target Start/End: Original strand, 25612274 - 25612344
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||| || ||||||||||||| ||||| || |||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
25612274 |
tttttttttgtggtggtcgggggttgaatcccggaccttgcatatattatgcattgtccatacaaactgag |
25612344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 139 - 197
Target Start/End: Complemental strand, 29544707 - 29544649
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| |||||||||| |||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
29544707 |
ttttttttggtggtggccggggtttgaaccccggaccttgcatatattatgcattgtcc |
29544649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 139 - 197
Target Start/End: Original strand, 31815868 - 31815926
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || |||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
31815868 |
tttttttttgtggtggtcggggtttgaaccccggaccttgcatatattatgcattgtcc |
31815926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 139 - 200
Target Start/End: Complemental strand, 20200785 - 20200724
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||| || ||||||| ||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
20200785 |
tttttttttgtggtggccggggtttgaaccctggaccttgcatatattatgcattgttcata |
20200724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 140 - 213
Target Start/End: Original strand, 24592828 - 24592901
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||| |||||||||| |||||||||||||| ||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
24592828 |
tttttttggtggtggccggggtttgaaccccagaccttgcatatattatgcattgtccctaccaactgagctaa |
24592901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 152 - 213
Target Start/End: Complemental strand, 27244724 - 27244663
Alignment:
| Q |
152 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||| |||||||||| ||||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
27244724 |
tggtcgggctttgaaccctagaccttgcatatattatgcattgtccctatcaactgagctaa |
27244663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 145 - 213
Target Start/End: Complemental strand, 27411166 - 27411098
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| ||||||| |||||| |||||||||||| |||||||| |||||||| ||||||||||| |
|
|
| T |
27411166 |
ttggtggtggccggggttcgaaccccggaccttgcatatattatgcaaggtccatatcaactgagctaa |
27411098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 145 - 213
Target Start/End: Complemental strand, 33064060 - 33063992
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| ||| ||| |||| | |||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
33064060 |
ttggtggtggccggagttcgaactccggaccttgcatatattatgcattgtccatatcaactgagctaa |
33063992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 158 - 213
Target Start/End: Original strand, 25598562 - 25598617
Alignment:
| Q |
158 |
gggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
25598562 |
gggttcgaaccctggaccttgcatatattatgcattgtccataccaactgagctaa |
25598617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 145 - 208
Target Start/End: Complemental strand, 25625790 - 25625727
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactga |
208 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||| |||| |||||| |||||||||| ||||||| |
|
|
| T |
25625790 |
ttggtggtggtccgggtttgaaccccggaccttacatatattatgaattgtccatacaaactga |
25625727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 139 - 198
Target Start/End: Complemental strand, 42791375 - 42791316
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcca |
198 |
Q |
| |
|
||||| ||||| |||| |||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
42791375 |
ttttttttggtagtggccggggtttgaaccccggaccttgcatatattatgcattgtcca |
42791316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 43043145 - 43043220
Alignment:
| Q |
139 |
tttttattggtggtggtcgggg-tttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || ||||||||||||| ||||||||| |||||||||||||||||||||||||| ||| ||| ||||||| |
|
|
| T |
43043145 |
tttttttttgtggtggtcgggggtttgaaccccggaccttgcatacattatgcattgtctataccaaccgagctaa |
43043220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 148 - 214
Target Start/End: Original strand, 6723067 - 6723133
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||| |||| |||| ||||||||||||||||||| ||||| |||||||||||| ||||||| |||| |
|
|
| T |
6723067 |
gtggtagtcgaggttcgaaccctggaccttgcatatattatacattgtccatatcaactgagttaaa |
6723133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 151 - 197
Target Start/End: Original strand, 18693655 - 18693701
Alignment:
| Q |
151 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
18693655 |
gtggtcggggtttgaaccctggatcttgcatatattatgcattgtcc |
18693701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 24593456 - 24593382
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| ||||||||| || ||||| |||||| |||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
24593456 |
ttttttttggtggtgttcagggttcgaaccccggaccttgcatatattatgcattgtccttaccaactgagctaa |
24593382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 31543092 - 31543018
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || |||||||| ||||||||||||| |||||||||||| |||||||||| |||||| | ||||||||| |
|
|
| T |
31543092 |
tttttttttgtggtggttggggtttgaaccccggaccttgcatatattatgcattatccataccatctgagctaa |
31543018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 160 - 213
Target Start/End: Original strand, 1861811 - 1861864
Alignment:
| Q |
160 |
gtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||| | ||||||||| |
|
|
| T |
1861811 |
gtttgaaccatggaccttgcatatattatgcattgtccatatcagctgagctaa |
1861864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 140 - 213
Target Start/End: Complemental strand, 6765689 - 6765616
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||| ||||||||||||| |||| |||||| ||||||| |||| |||||||||||||||| ||||||||||| |
|
|
| T |
6765689 |
tttttttggtggtggtcgtggttcgaaccccggaccttacatattttatgcattgtccataccaactgagctaa |
6765616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 148 - 213
Target Start/End: Complemental strand, 7350617 - 7350552
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||| || |||||||||| ||| ||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
7350617 |
gtggtggtcaggatttgaaccctagactttgcatatattatgcattgtccataccaactgagctaa |
7350552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 144 - 193
Target Start/End: Complemental strand, 27848233 - 27848184
Alignment:
| Q |
144 |
attggtggtggtcggggtttgaaccctggaccttgcatacattatgcatt |
193 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
27848233 |
attggtggtggccggggtttgaaccccggaccttgcatatattatgcatt |
27848184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 139 - 212
Target Start/End: Original strand, 41778925 - 41778998
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagcta |
212 |
Q |
| |
|
||||| |||||||||| |||| || ||||| |||||||||||| ||||||||||||||| || |||||||||| |
|
|
| T |
41778925 |
ttttttttggtggtggccgggattcgaacctcggaccttgcatatattatgcattgtccaaatcaactgagcta |
41778998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 145 - 213
Target Start/End: Original strand, 346111 - 346179
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||| | || | ||||||||||| |
|
|
| T |
346111 |
ttggtagtggtcggggtttgaaccctggaccttacatatattatgcattattcaaaccaactgagctaa |
346179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 4509595 - 4509543
Alignment:
| Q |
161 |
tttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||| ||| ||||||| |
|
|
| T |
4509595 |
tttgaaccttggaccttgcatatattatgcattgtccatatcaaccgagctaa |
4509543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 145 - 209
Target Start/End: Original strand, 5168566 - 5168630
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
|||||||| |||||||||||||||| | |||||||||| |||||||||| ||| ||| ||||||| |
|
|
| T |
5168566 |
ttggtggtagtcggggtttgaaccccgaaccttgcatatattatgcattatccctatcaactgag |
5168630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 139 - 214
Target Start/End: Complemental strand, 19976234 - 19976158
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcata-cattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||| || |||||||||| |||| |||||| |||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
19976234 |
tttttttttgtggtggtcgaggttcgaaccccggaccttgcatattattatgcattgtccataccaactgagctaaa |
19976158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 148 - 196
Target Start/End: Original strand, 20990894 - 20990942
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
196 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
20990894 |
gtggtggtcggggtttgaaccctgaaccttgcatattttatgcattgtc |
20990942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 145 - 213
Target Start/End: Complemental strand, 36474836 - 36474768
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| ||| ||||||||| |||||||||||| ||||||||||||| ||| ||||||||||| |
|
|
| T |
36474836 |
ttggtggtggccggaatttgaaccccggaccttgcatattttatgcattgtccctatcaactgagctaa |
36474768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 149 - 213
Target Start/End: Complemental strand, 44526198 - 44526134
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||| ||||||||||| || ||||||||| || ||||||||||||||||| ||||||||||| |
|
|
| T |
44526198 |
tggtggccggggtttgaatcccggaccttgcgtatattatgcattgtccataccaactgagctaa |
44526134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 139 - 198
Target Start/End: Original strand, 23406999 - 23407058
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcca |
198 |
Q |
| |
|
||||| || ||||||||| |||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
23406999 |
ttttttttcgtggtggtcagggtttgaaccccagaccttgcatatattatgcattgtcca |
23407058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 139 - 198
Target Start/End: Original strand, 24579649 - 24579708
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcca |
198 |
Q |
| |
|
||||| || ||||||| | | ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
24579649 |
tttttttttgtggtggccagagtttgaaccctggaccttgcatatattatgcattgtcca |
24579708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 139 - 214
Target Start/End: Original strand, 29133465 - 29133540
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||| || ||||||||||||||| ||||||| || |||||||| ||||||||||| |||| |||||||||||| |
|
|
| T |
29133465 |
tttttttttgtggtggtcggggttcgaaccctagatcttgcatattttatgcattgttcataccaactgagctaaa |
29133540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 32458367 - 32458312
Alignment:
| Q |
154 |
gtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||| | ||| ||||||| |
|
|
| T |
32458367 |
gtcggagtttgaaccctggaccttgcatatattatgcattgttcttatcaactgag |
32458312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 209
Target Start/End: Complemental strand, 2257051 - 2256981
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||| || ||||||| ||||||| |||||| ||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
2257051 |
tttttttttgtggtggccggggttcgaaccccagaccttgcatatattatgcattgtccataccaactgag |
2256981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 209
Target Start/End: Original strand, 12599846 - 12599916
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||| || ||||||||||||||| |||||| ||||||||||| |||||| |||||||||| ||||||| |
|
|
| T |
12599846 |
tttttttttgtggtggtcggggttcgaaccccagaccttgcatatattatgtattgtccatactaactgag |
12599916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 147 - 213
Target Start/End: Complemental strand, 19967490 - 19967424
Alignment:
| Q |
147 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||| ||||||||| | | |||||||| | |||||||||||| ||||| ||||||||||| |
|
|
| T |
19967490 |
ggtggtggtcgaggtttgaactccgaaccttgcacatattatgcattgttcatatcaactgagctaa |
19967424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 20455971 - 20455897
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || ||||||| |||| || |||||| |||||||||||| ||||||||||||||||| || |||||||| |
|
|
| T |
20455971 |
tttttttttgtggtggccgggattcgaaccccggaccttgcatatattatgcattgtccataccaattgagctaa |
20455897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 145 - 195
Target Start/End: Original strand, 25395429 - 25395479
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
||||||||||||||| |||||||| || |||||||||| |||||||||||| |
|
|
| T |
25395429 |
ttggtggtggtcgggatttgaaccttgaaccttgcatatattatgcattgt |
25395479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 156 - 214
Target Start/End: Complemental strand, 25626083 - 25626025
Alignment:
| Q |
156 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||||| ||||||| || |||||||| |||||||| |||||||||||||| ||||||| |
|
|
| T |
25626083 |
cggggttcgaaccctcgagcttgcatatattatgcaatgtccatataaactaagctaaa |
25626025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 145 - 195
Target Start/End: Original strand, 29896281 - 29896331
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
29896281 |
ttggtggtggtcggggtttgaaccccaaaccttgcatatattatgcattgt |
29896331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 147 - 213
Target Start/End: Original strand, 35820290 - 35820356
Alignment:
| Q |
147 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||| || ||||||||||| ||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
35820290 |
ggtggtggccgaggtttgaaccccggaccttgcatgtattatgcattgtccctaccaactgagctaa |
35820356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 151 - 213
Target Start/End: Original strand, 40853811 - 40853873
Alignment:
| Q |
151 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||||||| ||| |||||||||||| ||||||||| | ||||| ||||||||||| |
|
|
| T |
40853811 |
gtggtcggggtttgatccccggaccttgcatatattatgcatatttcatatcaactgagctaa |
40853873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 149 - 214
Target Start/End: Original strand, 3197071 - 3197135
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||||||||||||||||| || | |||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
3197071 |
tggtggtcggggtttgaatcc-gaaccttgcatatattatgcattgtccctaccaactgagctaaa |
3197135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 140 - 193
Target Start/End: Complemental strand, 4180776 - 4180723
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcatt |
193 |
Q |
| |
|
|||| ||||| ||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
4180776 |
tttttttggtagtggtcggggtttgaaccccggaccttgcatattttatgcatt |
4180723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 148 - 213
Target Start/End: Complemental strand, 4238830 - 4238765
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||| ||| |||||| | ||||| |||| ||||||||||||||||| ||||||||||| |
|
|
| T |
4238830 |
gtggtggtcggagttcgaaccccgaaccttacatatattatgcattgtccatactaactgagctaa |
4238765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 151 - 200
Target Start/End: Original strand, 8091151 - 8091200
Alignment:
| Q |
151 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||||| |||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
8091151 |
gtggtcgatgtttgaaccccggaccttgcatatattatgcattgtccata |
8091200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 139 - 192
Target Start/End: Complemental strand, 8728899 - 8728846
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcat |
192 |
Q |
| |
|
||||| || |||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
8728899 |
tttttttttgtggtggtcggggtttgaaccctggatcttgcatattttatgcat |
8728846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 156 - 197
Target Start/End: Complemental strand, 11560561 - 11560520
Alignment:
| Q |
156 |
cggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
11560561 |
cggggtttgaaccctgaaccttgcatatattatgcattgtcc |
11560520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 136 - 213
Target Start/End: Original strand, 20120699 - 20120776
Alignment:
| Q |
136 |
gtctttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||| || |||||| |||| ||||||||| | |||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
20120699 |
gtctttttttttgtggtgtccgggatttgaaccccgaaccttgcatatattatgcattgtccttaccaactgagctaa |
20120776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 145 - 214
Target Start/End: Original strand, 21482506 - 21482575
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||| ||||| |||| ||| || |||||||||||| |
|
|
| T |
21482506 |
ttggtggtggtcggggttcaaaccccggaccttgcatatattatacattatccttaccaactgagctaaa |
21482575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 148 - 213
Target Start/End: Original strand, 24581007 - 24581072
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||||||||||||| | |||||||||| |||||||||||| ||| ||||||||||| |
|
|
| T |
24581007 |
gtggtggtcggggtttgaacctcgaaccttgcatatattatgcattgtttttatgaactgagctaa |
24581072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 139 - 200
Target Start/End: Original strand, 36264460 - 36264521
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||| || |||||||||||||||||||||| | || ||||||| |||||||||| |||||| |
|
|
| T |
36264460 |
tttttttttgtggtggtcggggtttgaaccccgaactttgcatatattatgcattatccata |
36264521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 148 - 213
Target Start/End: Original strand, 36648780 - 36648845
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
36648780 |
gtggtggtcggggtttaaaccctagaccttgcatatcctattcattgtccataccaactgagctaa |
36648845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 156 - 213
Target Start/End: Original strand, 41763876 - 41763933
Alignment:
| Q |
156 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||||||| ||||| |||||| | ||||||||||||||| ||||||||||| |
|
|
| T |
41763876 |
cggggtttgaaccccggaccgtgcatatactatgcattgtccataccaactgagctaa |
41763933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 149 - 214
Target Start/End: Complemental strand, 41859922 - 41859857
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||| |||||||||||||||| ||||||| |||| |
|
|
| T |
41859922 |
tggtggccggggtttgaaccccagaccttgcatattttatgcattgtccataccaactgagttaaa |
41859857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 140 - 197
Target Start/End: Complemental strand, 42347747 - 42347690
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
|||| ||||| |||||||| |||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
42347747 |
tttttttggtagtggtcggagtttgaacactggaccttgcatattttatgcattgtcc |
42347690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 139 - 215
Target Start/End: Complemental strand, 4138071 - 4137995
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaag |
215 |
Q |
| |
|
||||| || ||||||||||||||||||| | |||||||||||| ||||| |||||||| || || |||||||||| |
|
|
| T |
4138071 |
tttttttttgtggtggtcggggtttgaatctcggaccttgcatatattatacattgtccttaccaattgagctaaag |
4137995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 15427750 - 15427698
Alignment:
| Q |
161 |
tttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| ||||||||||| ||||| ||||||||||| ||||||||||| |
|
|
| T |
15427750 |
tttgaaccctagaccttgcatatattatatattgtccatatcaactgagctaa |
15427698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 22571868 - 22571920
Alignment:
| Q |
161 |
tttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||| |||| ||||||| ||||||||||||| |||| ||||||||||| |
|
|
| T |
22571868 |
tttgaaccccggacattgcatatattatgcattgtctatatcaactgagctaa |
22571920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 138 - 214
Target Start/End: Complemental strand, 28771663 - 28771587
Alignment:
| Q |
138 |
ctttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||||| ||||||||| ||||||| ||||| ||| |||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
28771663 |
cttttttttggtggtgtccggggttcgaaccgcggatcttgcatatattatgcattgtccttaccaactgagctaaa |
28771587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 145 - 213
Target Start/End: Complemental strand, 29600013 - 29599945
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| |||||||| |||||||||| |||||||| ||| |||||||||| |||| | ||||||||||| |
|
|
| T |
29600013 |
ttggtagtggtcggagtttgaaccccggaccttggatatattatgcattatccaaaccaactgagctaa |
29599945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 213
Target Start/End: Complemental strand, 30089119 - 30089055
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||| || ||||||||||| |||||||| ||| |||||||||||||| || ||||||||||| |
|
|
| T |
30089119 |
tggtggccgaggtttgaaccccggaccttgtatatattatgcattgtccctaccaactgagctaa |
30089055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 213
Target Start/End: Complemental strand, 30125723 - 30125659
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||| || ||||||||||| |||||||| ||| |||||||||||||| || ||||||||||| |
|
|
| T |
30125723 |
tggtggccgaggtttgaaccccggaccttgtatatattatgcattgtccctaccaactgagctaa |
30125659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 209
Target Start/End: Complemental strand, 34977274 - 34977214
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
|||||| |||||||| ||| | |||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
34977274 |
tggtggccggggtttaaactccggaccttgcatatattatgcattgtccataccaactgag |
34977214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 148 - 192
Target Start/End: Complemental strand, 37852081 - 37852037
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcat |
192 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37852081 |
gtggtggttagggtttgaaccctggaccttgcatatattatgcat |
37852037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 139 - 195
Target Start/End: Complemental strand, 38904141 - 38904085
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
||||| || |||||||| |||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
38904141 |
tttttttttgtggtggttagggtttgaaccctgaaccttgcatatattatgcattgt |
38904085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 145 - 213
Target Start/End: Complemental strand, 42066786 - 42066718
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| || |||| ||||| |||||||||||| ||| ||||||||||||| ||||||||||| |
|
|
| T |
42066786 |
ttggtggtggccgaggttcaaaccccggaccttgcatatattgtgcattgtccataccaactgagctaa |
42066718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 7052854 - 7052779
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcata-cattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| ||||||||| |||||||||| ||| |||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
7052854 |
ttttttttggtggtgtccggggtttgagccccggaccttgcatattattatgcattgtccttaccaactgagctaa |
7052779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 159 - 214
Target Start/End: Complemental strand, 12124605 - 12124550
Alignment:
| Q |
159 |
ggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||| |||||| |||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
12124605 |
ggttcgaaccccggaccttgcatatattatgcattgtccttaccaactgagctaaa |
12124550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 159 - 198
Target Start/End: Complemental strand, 36359374 - 36359335
Alignment:
| Q |
159 |
ggtttgaaccctggaccttgcatacattatgcattgtcca |
198 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
36359374 |
ggtttgaaccccggaccttgcatatattatgcattgtcca |
36359335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 149 - 212
Target Start/End: Original strand, 40994768 - 40994831
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagcta |
212 |
Q |
| |
|
|||||||||| |||||||||| | ||||||||| |||||| ||||||||||| || ||||||| |
|
|
| T |
40994768 |
tggtggtcggtgtttgaaccccgaaccttgcatctattatgtattgtccatatcaattgagcta |
40994831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 197
Target Start/End: Complemental strand, 3708773 - 3708715
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || ||||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
3708773 |
tttttttttgtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
3708715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 4927430 - 4927504
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || ||| ||| |||||||||||||| ||||||| |||| ||||||| |||||| || ||||||||||| |
|
|
| T |
4927430 |
tttttttttgtgatggccggggtttgaaccccggaccttacatatattatgctttgtccctaccaactgagctaa |
4927504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 214
Target Start/End: Complemental strand, 4958696 - 4958658
Alignment:
| Q |
176 |
ttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
4958696 |
ttgcatacattatacattgtccatatcaactgagctaaa |
4958658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 213
Target Start/End: Complemental strand, 7262874 - 7262812
Alignment:
| Q |
151 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||| ||||||||||| | | || |||| ||| |||||||||||||||||| ||||||||||| |
|
|
| T |
7262874 |
gtggccggggtttgaatctttgatcttgtatatattatgcattgtccatatcaactgagctaa |
7262812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 10156097 - 10156023
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| ||||||||||||||| || |||| | | |||||||||| |||||| ||||||| || ||||||||||| |
|
|
| T |
10156097 |
ttttttttggtggtggtcgggattcgaacaccgaaccttgcatatattatgtattgtccttaccaactgagctaa |
10156023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 10195643 - 10195717
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || |||||| || |||||||||| | || |||||||| |||||||||| ||||||| ||||||||||| |
|
|
| T |
10195643 |
tttttttttgtggtgatcagggtttgaactccagatcttgcatatattatgcattatccatatcaactgagctaa |
10195717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 197
Target Start/End: Original strand, 11868643 - 11868701
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || ||||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
11868643 |
tttttttttgtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
11868701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 200
Target Start/End: Original strand, 21870876 - 21870938
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcata-cattatgcattgtccata |
200 |
Q |
| |
|
||||| || ||||||||||||||| |||||| | |||||||||| ||||||||||||||||| |
|
|
| T |
21870876 |
tttttttttgtggtggtcggggttcgaaccccgaaccttgcatattattatgcattgtccata |
21870938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 140 - 214
Target Start/End: Complemental strand, 22267591 - 22267518
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||| ||||||||||||||||||||||| | |||||||||| |||||||||||||| || ||||||| |||| |
|
|
| T |
22267591 |
tttttttggtggtggtcggggtttgaactc-aaaccttgcatatattatgcattgtccgtaccaactgagttaaa |
22267518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 140 - 198
Target Start/End: Complemental strand, 22559056 - 22558998
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcca |
198 |
Q |
| |
|
|||||||||||||||||||| ||||||| | ||||||| ||| |||||||||||||| |
|
|
| T |
22559056 |
ttttattggtggtggtcgggttttgaactccagaccttgtatattttatgcattgtcca |
22558998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 214
Target Start/End: Original strand, 35281205 - 35281267
Alignment:
| Q |
152 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||||||||||||||| | |||||||||| ||||| |||| ||||| | |||||||||||| |
|
|
| T |
35281205 |
tggtcggggtttgaacctcgaaccttgcatatattatacattatccatttcaactgagctaaa |
35281267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 197
Target Start/End: Original strand, 35360036 - 35360094
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || ||||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
35360036 |
tttttttttgtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
35360094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 164 - 214
Target Start/End: Original strand, 35685067 - 35685117
Alignment:
| Q |
164 |
gaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
35685067 |
gaaccctagaccttgcatatattatgcattgtccttaccaactgagctaaa |
35685117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 172 - 214
Target Start/End: Complemental strand, 39761485 - 39761443
Alignment:
| Q |
172 |
gaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||||||||| |||||||||||||| ||| |||||||||||| |
|
|
| T |
39761485 |
gaccttgcatatattatgcattgtccttatcaactgagctaaa |
39761443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 209
Target Start/End: Complemental strand, 44694768 - 44694698
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||| || ||| ||| |||||||||||||| | ||||||||| ||||||||||||| |||| ||||||| |
|
|
| T |
44694768 |
tttttttttgtgttggccggggtttgaaccccgagccttgcatatattatgcattgtctatatcaactgag |
44694698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 140 - 194
Target Start/End: Complemental strand, 44810784 - 44810730
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattg |
194 |
Q |
| |
|
|||| |||||||||| ||||||||||||| |||||||||||| |||||| |||| |
|
|
| T |
44810784 |
tttttttggtggtggctggggtttgaaccccggaccttgcatatattatgtattg |
44810730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 158 - 215
Target Start/End: Original strand, 145011 - 145068
Alignment:
| Q |
158 |
gggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaag |
215 |
Q |
| |
|
|||||| ||||||| ||||| |||| ||||||||||||||||| ||||||| ||||| |
|
|
| T |
145011 |
gggtttaaaccctgaaccttacatatattatgcattgtccataccaactgagttaaag |
145068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 152 - 213
Target Start/End: Original strand, 3113721 - 3113782
Alignment:
| Q |
152 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||| |||||| || |||||||||||| ||||||||||||| ||| |||||| |||| |
|
|
| T |
3113721 |
tggtcgggatttgaatcccggaccttgcatattttatgcattgtccttatcaactgaactaa |
3113782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 139 - 196
Target Start/End: Original strand, 4557752 - 4557809
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
196 |
Q |
| |
|
||||| || ||||||||| ||||||||||| ||||||| |||| ||||||||||||| |
|
|
| T |
4557752 |
tttttcttcgtggtggtcagggtttgaaccacggaccttacatatattatgcattgtc |
4557809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 149 - 182
Target Start/End: Original strand, 9064580 - 9064613
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcata |
182 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
9064580 |
tggtggtcggggtttgaaccctgaaccttgcata |
9064613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 139 - 200
Target Start/End: Original strand, 9581268 - 9581328
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||| || ||||||| | |||||||||||| |||||||||||| ||||| ||||||||||| |
|
|
| T |
9581268 |
tttttttttgtggtggccagggtttgaaccc-ggaccttgcatatattattcattgtccata |
9581328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 164 - 209
Target Start/End: Complemental strand, 14364109 - 14364064
Alignment:
| Q |
164 |
gaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||| ||||||| |
|
|
| T |
14364109 |
gaaccctggaccttacatatattatgcattgtccataccaactgag |
14364064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 148 - 213
Target Start/End: Original strand, 22523002 - 22523067
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||| |||| |||||||| | |||||||||| |||||| |||||||||| ||||||||||| |
|
|
| T |
22523002 |
gtggtggccgggatttgaacctcgaaccttgcatatattatgtattgtccataccaactgagctaa |
22523067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 151 - 196
Target Start/End: Complemental strand, 22709153 - 22709108
Alignment:
| Q |
151 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
196 |
Q |
| |
|
|||| |||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
22709153 |
gtggccggggtttgaaccccggaccttgcatattttatgcattgtc |
22709108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 164 - 213
Target Start/End: Original strand, 24305311 - 24305360
Alignment:
| Q |
164 |
gaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||| | |||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
24305311 |
gaaccccgaaccttgcatattttatgcattgtccatattaactgagctaa |
24305360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 148 - 213
Target Start/End: Original strand, 29872162 - 29872227
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| |||||||||| | ||||||||||| |||||| ||||| |||| |||||| |||| |
|
|
| T |
29872162 |
gtggtggtcgaggtttgaaccttagaccttgcatatattatgtattgttcataccaactgaactaa |
29872227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 145 - 214
Target Start/End: Complemental strand, 31477045 - 31476976
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||||||||| |||| ||||||||| | |||||| ||| |||||||||| ||| || |||||||||||| |
|
|
| T |
31477045 |
ttggtggtggccgggatttgaaccccgaaccttgtatatattatgcattctccctaccaactgagctaaa |
31476976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 164 - 213
Target Start/End: Original strand, 34685970 - 34686019
Alignment:
| Q |
164 |
gaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||| | ||||||||||| |
|
|
| T |
34685970 |
gaaccccggaccttacatacattatgcattgtccaaaccaactgagctaa |
34686019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 164 - 213
Target Start/End: Original strand, 34708391 - 34708440
Alignment:
| Q |
164 |
gaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||| | ||||||||||| |
|
|
| T |
34708391 |
gaaccccggaccttacatacattatgcattgtccaaaccaactgagctaa |
34708440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 139 - 212
Target Start/End: Original strand, 36441148 - 36441221
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagcta |
212 |
Q |
| |
|
||||| || ||||||||| |||||| ||||| |||| |||||| ||||||||||||| ||| |||||||||| |
|
|
| T |
36441148 |
tttttttttgtggtggtcagggttttaaccccggacaatgcatatattatgcattgtctataccaactgagcta |
36441221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 157 - 214
Target Start/End: Original strand, 43117189 - 43117246
Alignment:
| Q |
157 |
ggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
43117189 |
ggggtttgaacctcagaccttgcatatattatgcattgtccttaccaactgagctaaa |
43117246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 3617162 - 3617114
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
|||||| ||| ||||||||||||||| |||| || |||||||||||||| |
|
|
| T |
3617162 |
tggtggccggagtttgaaccctggactttgcgtatattatgcattgtcc |
3617114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 172 - 212
Target Start/End: Complemental strand, 5980274 - 5980234
Alignment:
| Q |
172 |
gaccttgcatacattatgcattgtccatataaactgagcta |
212 |
Q |
| |
|
||||||||||| |||||||||||||| ||| |||||||||| |
|
|
| T |
5980274 |
gaccttgcatatattatgcattgtccttatcaactgagcta |
5980234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 213
Target Start/End: Original strand, 9383224 - 9383264
Alignment:
| Q |
173 |
accttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
9383224 |
accttgcatatattatgcattgtccataccaactgagctaa |
9383264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 213
Target Start/End: Original strand, 9519729 - 9519769
Alignment:
| Q |
173 |
accttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| |||||||||||||||||| || |||||||| |
|
|
| T |
9519729 |
accttgcatatattatgcattgtccatatcaattgagctaa |
9519769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 200
Target Start/End: Complemental strand, 11175856 - 11175804
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||||| ||| |||||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
11175856 |
gtggtggccggagtttgaaccccagatcttgcatatattatgcattgtccata |
11175804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 209
Target Start/End: Complemental strand, 19160007 - 19159951
Alignment:
| Q |
153 |
ggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
|||||| |||||||| | | |||||||||| |||||||||||| ||||| ||||||| |
|
|
| T |
19160007 |
ggtcggagtttgaactccgaaccttgcatatattatgcattgttcatatcaactgag |
19159951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 213
Target Start/End: Original strand, 25561984 - 25562052
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||||||| |||||||||| || |||||||| ||||||| ||||| || ||||||||||| |
|
|
| T |
25561984 |
ttggtggtggtcggagtttgaaccccagatcttgcatattttatgcactgtccttaccaactgagctaa |
25562052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 213
Target Start/End: Complemental strand, 28202359 - 28202303
Alignment:
| Q |
157 |
ggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||| ||||||| |||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
28202359 |
ggggtttgaacttcggaccttacatatattatgcattgtccctatcaactgagctaa |
28202303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 213
Target Start/End: Complemental strand, 30243324 - 30243256
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| || ||||||||||| | |||||| ||| ||||||||||||| || ||||||||||| |
|
|
| T |
30243324 |
ttggtggtggccgaggtttgaaccccgaaccttgtatatattatgcattgtctctaccaactgagctaa |
30243256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 147 - 195
Target Start/End: Original strand, 34469861 - 34469909
Alignment:
| Q |
147 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||| |||||||||| |
|
|
| T |
34469861 |
ggtggtggtcggggttcgaaccccggaccttgcataagctatgcattgt |
34469909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 209
Target Start/End: Original strand, 36615024 - 36615084
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||||||||||||| |||| | ||||||||||| | ||| ||||||||||| ||||||| |
|
|
| T |
36615024 |
tggtggtcggggtttaaaccttagaccttgcatatactatccattgtccataccaactgag |
36615084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 39068715 - 39068763
Alignment:
| Q |
165 |
aaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| ||| |||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
39068715 |
aaccccggatcttgcatatattatgcattgtccttatcaactgagctaa |
39068763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 197
Target Start/End: Original strand, 43356620 - 43356672
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
|||||||||||||||||||| ||| || ||||| ||| |||||||||||||| |
|
|
| T |
43356620 |
ttggtggtggtcggggtttggaccatgaaccttctatatattatgcattgtcc |
43356672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 6e-18; HSPs: 123)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 34899177 - 34899103
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| ||| ||||||||||||||||||||| |||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
34899177 |
ttttttttgttggtggtcggggtttgaaccccggaccttgcatatattatgcattgtccctacgaactgagctaa |
34899103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 139 - 209
Target Start/End: Original strand, 38130940 - 38131010
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||| |||||||||| |||||||||||||| |||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
38130940 |
ttttttttggtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccataccaactgag |
38131010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 140 - 213
Target Start/End: Original strand, 25340906 - 25340979
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||| |||||||||| |||||||||||||| |||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
25340906 |
tttttttggtggtggccggggtttgaaccccggaccttgcatattttatgcattgtccataccaactgagctaa |
25340979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 25441481 - 25441555
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || ||||||| |||||||||||||| ||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
25441481 |
tttttttttgtggtggccggggtttgaaccccagaccttgcatatattatgcattgtccataccaactgagctaa |
25441555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 139 - 209
Target Start/End: Original strand, 51882181 - 51882251
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||| || ||||||| |||||||||||||||||| |||||||| ||||||||||||||||| ||||||| |
|
|
| T |
51882181 |
tttttttttgtggtggccggggtttgaaccctggatcttgcatatattatgcattgtccataccaactgag |
51882251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 139 - 200
Target Start/End: Original strand, 8136613 - 8136674
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||| || ||||||||||||||||||||| ||||||||||||| ||||||||| ||||||| |
|
|
| T |
8136613 |
tttttttttgtggtggtcggggtttgaaccttggaccttgcatatattatgcatcgtccata |
8136674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 140 - 213
Target Start/End: Original strand, 16792956 - 16793029
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||||| ||||||||||||| ||| ||||| ||||| |
|
|
| T |
16792956 |
tttttttggtggtgaccggggtttgaaccctggaccttgcatatattatgcattgtctataccaactgtgctaa |
16793029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 147 - 200
Target Start/End: Original strand, 25727956 - 25728009
Alignment:
| Q |
147 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
25727956 |
ggtggtggtcgggatttgaaccccggaccttgcatatattatgcattgtccata |
25728009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 140 - 213
Target Start/End: Complemental strand, 29631265 - 29631192
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||| |||||||||| ||||||||||| || | |||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
29631265 |
tttttttggtggtggccggggtttgaatcccgaaccttgcatatattatgcattgtccataccaactgagctaa |
29631192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 139 - 200
Target Start/End: Complemental strand, 45727569 - 45727508
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||| || ||||||||||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45727569 |
tttttttttgtggtggtcggagtttgaaccctaaaccttgcatacattatgcattgtccata |
45727508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 145 - 214
Target Start/End: Original strand, 48209198 - 48209267
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||| |||||| ||||||| ||| |||||||||||| |
|
|
| T |
48209198 |
ttggtggtggtcggggtttgaaccctgaaccttatatatattatgtattgtccctatcaactgagctaaa |
48209267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 139 - 191
Target Start/End: Complemental strand, 552254 - 552202
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgca |
191 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
552254 |
ttttttttggtggaggtcggggtttgaaccctggaccttgcatatattatgca |
552202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 145 - 209
Target Start/End: Original strand, 986940 - 987004
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||| |||||||| |||||||||| |
|
|
| T |
986940 |
ttggtagtggtcggggtttgaaccctggaccttgcatattttatacattgtccgaataaactgag |
987004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 140 - 198
Target Start/End: Complemental strand, 4601923 - 4601865
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcca |
198 |
Q |
| |
|
|||| |||||||||| |||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
4601923 |
tttttttggtggtggccggggtttgaaccccggaccttgcatttattatgcattgtcca |
4601865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 139 - 197
Target Start/End: Original strand, 7464472 - 7464530
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || |||||||||||||||||||||| ||||||| |||| |||||||||||||| |
|
|
| T |
7464472 |
tttttttttgtggtggtcggggtttgaaccccggaccttacatatattatgcattgtcc |
7464530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 21549118 - 21549044
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || ||| ||||||||||| ||||||| |||||||||| ||||| |||||||||||| ||||||||||| |
|
|
| T |
21549118 |
tttttttttgtgatggtcggggttcgaaccctaaaccttgcatatattatacattgtccatatcaactgagctaa |
21549044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 50037391 - 50037317
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || ||||||| || |||||||||| | |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
50037391 |
ttttttttagtggtggctggagtttgaaccccgaaccttgcatacattatgcattgtccataccaactgagctaa |
50037317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 137 - 214
Target Start/End: Original strand, 1111820 - 1111897
Alignment:
| Q |
137 |
tctttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||||| ||| | ||||||||||||||||||| ||||||||||| |||||| ||||||| ||| ||||||| |||| |
|
|
| T |
1111820 |
tcttttttttgtttgtggtcggggtttgaaccccagaccttgcatatattatgtattgtccctatcaactgagttaaa |
1111897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 148 - 213
Target Start/End: Complemental strand, 22722473 - 22722408
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |||| ||||||||||| |
|
|
| T |
22722473 |
gtggtggtcggggtttgaacctcggaccttgcatattttatgcattgttcatactaactgagctaa |
22722408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 145 - 214
Target Start/End: Original strand, 32625406 - 32625475
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||| |||||| | ||||||| ||||||||||||| |
|
|
| T |
32625406 |
ttggtggtggtcggggtttgaaccctaaaccttgtatatattatgtaaggtccatacaaactgagctaaa |
32625475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 148 - 209
Target Start/End: Complemental strand, 40520823 - 40520762
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||||||| |||||| |||||||| |
|
|
| T |
40520823 |
gtggtggtcggggtttgaactttggaccttgcatattttatgcattatccatacaaactgag |
40520762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 148 - 213
Target Start/End: Complemental strand, 45432019 - 45431954
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||| | |||||||||||| |||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
45432019 |
gtggtggccagggtttgaaccccggaccttgcatatattatgcattgtccctaccaactgagctaa |
45431954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 152 - 200
Target Start/End: Original strand, 30554869 - 30554917
Alignment:
| Q |
152 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||| | ||||||||||||||| |
|
|
| T |
30554869 |
tggtcggggtttgaaccctgaaccttgcatatagtatgcattgtccata |
30554917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 148 - 196
Target Start/End: Original strand, 48849753 - 48849801
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
196 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
48849753 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtc |
48849801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 139 - 199
Target Start/End: Original strand, 48944337 - 48944396
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccat |
199 |
Q |
| |
|
||||| |||||||||||||| ||||||||||| || |||||||| |||||||||||||||| |
|
|
| T |
48944337 |
ttttttttggtggtggtcggagtttgaaccct-gatcttgcatatattatgcattgtccat |
48944396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 147 - 214
Target Start/End: Complemental strand, 3755411 - 3755344
Alignment:
| Q |
147 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||||||| || ||||| |||||||||||||||||| |||||||||||||| || ||| |||||||| |
|
|
| T |
3755411 |
ggtggtggccgaggtttaaaccctggaccttgcatatattatgcattgtccctaccaaccgagctaaa |
3755344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 146 - 213
Target Start/End: Original strand, 10498683 - 10498750
Alignment:
| Q |
146 |
tggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||| || ||||||||| | ||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
10498683 |
tggtggtggccgaggtttgaactcatgaccttgcatatattatgcattgtccataccaactgagctaa |
10498750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 149 - 200
Target Start/End: Complemental strand, 39779094 - 39779043
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||||| ||||||||||||| | |||||||||| ||||||||||||||||| |
|
|
| T |
39779094 |
tggtggttggggtttgaaccccgaaccttgcatatattatgcattgtccata |
39779043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 3100301 - 3100227
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| |||||||||| ||||||| |||||||||| ||||||| |||||||||||||| | ||||||||||| |
|
|
| T |
3100301 |
tttttgttggtggtggccggggttcaaaccctggactttgcatatgttatgcattgtccacaccaactgagctaa |
3100227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 197
Target Start/End: Original strand, 10922289 - 10922347
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || ||||| |||||||||||||||| ||| |||||||| |||||||||||||| |
|
|
| T |
10922289 |
tttttttttgtggtagtcggggtttgaaccccggatcttgcatatattatgcattgtcc |
10922347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 151 - 213
Target Start/End: Original strand, 11508476 - 11508538
Alignment:
| Q |
151 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||||| |||||| ||||| |||||| || ||||||||||||||| ||| ||||||| |
|
|
| T |
11508476 |
gtggtcggggttcgaaccccggaccctgcatatatcatgcattgtccatatcaaccgagctaa |
11508538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 14827605 - 14827531
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || ||||||| |||||||| ||||| ||| |||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
14827605 |
tttttttttgtggtggccggggtttaaaccccggatcttgcatattttatgcattgtccataccaactgagctaa |
14827531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 151 - 213
Target Start/End: Original strand, 16980347 - 16980409
Alignment:
| Q |
151 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||| |||||||| || |||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
16980347 |
gtggtcgggatttgaaccatgaaccttgcatatattatgcattgtccttaccaactgagctaa |
16980409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 18870706 - 18870780
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || ||||||| || |||||||| | ||||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
18870706 |
tttttttttgtggtggccgaggtttgaatcatggaccttgcatatattatgcattgtccctaccaactgagctaa |
18870780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 32629160 - 32629086
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || |||||||||| ||| |||||| |||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
32629160 |
tttttttttgtggtggtcgatgttcgaaccccggaccttgcatattttatgcattgtccataccaactgagctaa |
32629086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 209
Target Start/End: Original strand, 32909282 - 32909352
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||| || ||||||| |||| ||||||||| |||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
32909282 |
tttttttttgtggtggccgggatttgaacccaggaccttgcatattttatgcattgtccatactaactgag |
32909352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 140 - 198
Target Start/End: Complemental strand, 41817578 - 41817520
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcca |
198 |
Q |
| |
|
|||| |||||||||| |||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
41817578 |
tttttttggtggtggctagggtttgaaccccggaccttgcatatattatgcattgtcca |
41817520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 145 - 195
Target Start/End: Complemental strand, 45334263 - 45334213
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
||||||||||||||| ||||||||| | |||||||||| |||||||||||| |
|
|
| T |
45334263 |
ttggtggtggtcgggatttgaaccccgaaccttgcatatattatgcattgt |
45334213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 151 - 213
Target Start/End: Original strand, 48315017 - 48315079
Alignment:
| Q |
151 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||| ||||||||| |||||||||||| |||||||||| ||| || ||||||||||| |
|
|
| T |
48315017 |
gtggtcgggatttgaaccccggaccttgcatatattatgcattatccttaccaactgagctaa |
48315079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 171 - 213
Target Start/End: Complemental strand, 53821841 - 53821799
Alignment:
| Q |
171 |
ggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
53821841 |
ggaccttgcatacattatgcattgtccatatcaactgaactaa |
53821799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 53996379 - 53996305
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || ||||||| |||| || |||||| ||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
53996379 |
tttttttttgtggtggccgggattcgaaccccagaccttgcatatattatgcattgtccataccaactgagctaa |
53996305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 148 - 209
Target Start/End: Original strand, 7557524 - 7557585
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||||| || ||||||| | | |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7557524 |
gtggtggccgaggtttgatcgccggaccttgcatacattatgcattgtccataccaactgag |
7557585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 148 - 213
Target Start/End: Complemental strand, 27185548 - 27185483
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||| |||||| ||||||| || ||||||||||| |
|
|
| T |
27185548 |
gtggtggtcgaggtttgaaccccagaccttgcatatattatgtattgtccctaccaactgagctaa |
27185483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 148 - 213
Target Start/End: Original strand, 32843252 - 32843317
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||| |||||||||||||| | ||||||||||| |
|
|
| T |
32843252 |
gtggtggccggggtttgaaccccagaccttgcatattttatgcattgtccaaaccaactgagctaa |
32843317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 156 - 213
Target Start/End: Complemental strand, 44579699 - 44579642
Alignment:
| Q |
156 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||| |||||| |||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
44579699 |
cggggttcgaaccccggaccttgcatattttatgcattgtccataccaactgagctaa |
44579642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 160 - 209
Target Start/End: Complemental strand, 46903967 - 46903918
Alignment:
| Q |
160 |
gtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||| ||||||| |
|
|
| T |
46903967 |
gtttgaaccctggaccttacatatattatgcattgtccataccaactgag |
46903918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 148 - 213
Target Start/End: Original strand, 48796208 - 48796273
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||| |||||||||||||| | |||||||||| |||||||||||||| | ||||||||||| |
|
|
| T |
48796208 |
gtggtggccggggtttgaaccccgaaccttgcatatcttatgcattgtccaaactaactgagctaa |
48796273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 213
Target Start/End: Complemental strand, 54113403 - 54113346
Alignment:
| Q |
157 |
ggggtttgaaccctggaccttgcataca-ttatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||| |||||| |||||||||||||| |||||||||||| |||| ||||||||||| |
|
|
| T |
54113403 |
ggggttcgaacccgggaccttgcatacatttatgcattgtctatatcaactgagctaa |
54113346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 139 - 214
Target Start/End: Original strand, 334828 - 334904
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgca-ttgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||| || ||||||| |||||||||||||| |||||||||||| ||||||| ||||||||| ||||||| |||| |
|
|
| T |
334828 |
tttttttttgtggtggccggggtttgaaccccggaccttgcatattttatgcatttgtccataccaactgagttaaa |
334904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 977944 - 977996
Alignment:
| Q |
161 |
tttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||| | |||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
977944 |
tttgaactccggaccttgcatatattatgcattgtccataccaactgagctaa |
977996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 139 - 191
Target Start/End: Original strand, 6835832 - 6835884
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgca |
191 |
Q |
| |
|
||||| || ||||||||||||||| ||||||| ||||||||||| |||||||| |
|
|
| T |
6835832 |
tttttttttgtggtggtcggggttcgaaccctagaccttgcatatattatgca |
6835884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 212
Target Start/End: Complemental strand, 14894780 - 14894719
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagcta |
212 |
Q |
| |
|
|||||||| ||||||||||| |||||| ||||| ||||||||||||||||| |||||||||| |
|
|
| T |
14894780 |
tggtggtcagggtttgaaccttggacc--gcatatattatgcattgtccatagtaactgagcta |
14894719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 148 - 212
Target Start/End: Original strand, 22799716 - 22799780
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagcta |
212 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| ||||||||||||| || ||||||||||| |
|
|
| T |
22799716 |
gtggtggtcgaggtttgaacctcggaccttgcatgttttatgcattgtccttacaaactgagcta |
22799780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 197
Target Start/End: Original strand, 27065731 - 27065771
Alignment:
| Q |
157 |
ggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27065731 |
ggggtttgaaccctggaccttgcatattttatgcattgtcc |
27065771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 213
Target Start/End: Complemental strand, 33745161 - 33745105
Alignment:
| Q |
157 |
ggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||||||||| || |||||||| |
|
|
| T |
33745161 |
ggggtttgaaccccagaccttgcatattttatgcattgtccatatcaattgagctaa |
33745105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 145 - 193
Target Start/End: Complemental strand, 38603032 - 38602984
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcatt |
193 |
Q |
| |
|
|||||||||| ||||||||||||| || |||||||||| |||||||||| |
|
|
| T |
38603032 |
ttggtggtggccggggtttgaaccatgaaccttgcatatattatgcatt |
38602984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 152 - 200
Target Start/End: Original strand, 49082703 - 49082751
Alignment:
| Q |
152 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
|||||||||||||||||| |||||||||||| || || ||||||||||| |
|
|
| T |
49082703 |
tggtcggggtttgaaccccggaccttgcatatatcatacattgtccata |
49082751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 213
Target Start/End: Complemental strand, 52119446 - 52119382
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||| ||||||| |||||| | |||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
52119446 |
tggtggccggggttcgaaccccgaaccttgcatatattatgcattgtccttaccaactgagctaa |
52119382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 145 - 213
Target Start/End: Original strand, 52904131 - 52904198
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| |||||||||||||| ||| ||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
52904131 |
ttggtggtgg-cggggtttgaacccccgacattgcatatattatgcattgtccttaccaactgagctaa |
52904198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 140 - 199
Target Start/End: Original strand, 913582 - 913641
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccat |
199 |
Q |
| |
|
|||| |||||||||| | ||||||||||| |||||||||||| ||||||||||| |||| |
|
|
| T |
913582 |
tttttttggtggtggcagaggtttgaaccccggaccttgcatatattatgcattgcccat |
913641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 158 - 213
Target Start/End: Original strand, 1149069 - 1149124
Alignment:
| Q |
158 |
gggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| ||||||| ||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
1149069 |
gggttcgaaccctagaccttgcatatattatgcattgtccttaccaactgagctaa |
1149124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 139 - 214
Target Start/End: Complemental strand, 7824887 - 7824812
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||| ||||||||||||||| || |||| | ||||||||||| |||||| |||||| |||| ||||||| |||| |
|
|
| T |
7824887 |
ttttttttggtggtggtcgggtttcgaactccagaccttgcatatattatgtattgtctatatcaactgagttaaa |
7824812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 139 - 214
Target Start/End: Complemental strand, 7827588 - 7827513
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||| || |||||||||||| || |||| | |||||| |||| |||||||||||||||||| ||||||| |||| |
|
|
| T |
7827588 |
tttttttttgtggtggtcgggtttcgaactccagaccttacatatattatgcattgtccatatcaactgagttaaa |
7827513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 158 - 209
Target Start/End: Original strand, 16663236 - 16663287
Alignment:
| Q |
158 |
gggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||| |||||| ||||||| |
|
|
| T |
16663236 |
gggtttgaaccccggaccttgcatatattatgcattatccataccaactgag |
16663287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 158 - 213
Target Start/End: Original strand, 20370281 - 20370336
Alignment:
| Q |
158 |
gggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| ||||||| |||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
20370281 |
gggttcgaaccctaaaccttgcatattttatgcattgtccatatcaactgagctaa |
20370336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 158 - 213
Target Start/End: Original strand, 24428473 - 24428528
Alignment:
| Q |
158 |
gggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||| |||| ||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
24428473 |
gggtttgaacctcggactttgcatatattatgcattgtccataccaactgagctaa |
24428528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 151 - 213
Target Start/End: Original strand, 35347288 - 35347351
Alignment:
| Q |
151 |
gtggtcggggtttgaaccctggaccttgcatacattatgca-ttgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||| ||||||||||| ||||||||||| |||||||| ||||||||| ||||||||||| |
|
|
| T |
35347288 |
gtggtcgaggtttgaaccccagaccttgcatatattatgcatttgtccatagcaactgagctaa |
35347351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 139 - 214
Target Start/End: Original strand, 43344988 - 43345063
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||| || ||||| |||||| | ||||| |||||||||||||| |||||| ||||| |||| |||||||||||| |
|
|
| T |
43344988 |
tttttttttgtggttgtcgggatctgaactctggaccttgcatatattatgtattgttcataccaactgagctaaa |
43345063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 197
Target Start/End: Complemental strand, 916519 - 916461
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || ||||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
916519 |
tttttttttgtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
916461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 209
Target Start/End: Original strand, 2186408 - 2186478
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||| || ||| |||||||||||||||||| |||||| |||| |||||| |||||||||| ||||||| |
|
|
| T |
2186408 |
tttttttttgtgatggtcggggtttgaaccccagaccttacatatattatgtattgtccataccaactgag |
2186478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 4216381 - 4216454
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| ||||||||| | ||||| |||||| | |||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
4216381 |
ttttttttggtggtgtccagggttcgaaccccg-accttgcatatattatgcattgtccttatcaactgagctaa |
4216454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 209
Target Start/End: Complemental strand, 8075865 - 8075795
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||| || ||||||| ||||||||||||| ||||||||||| ||||||||||||| ||| ||||||| |
|
|
| T |
8075865 |
tttttttttgtggtggccggggtttgaacctcagaccttgcatatattatgcattgtctctattaactgag |
8075795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 197
Target Start/End: Complemental strand, 8238644 - 8238586
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || ||||||| ||| |||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
8238644 |
tttttttttgtggtggccggagtttgaaccccagaccttgcatatattatgcattgtcc |
8238586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 197
Target Start/End: Complemental strand, 10102879 - 10102821
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || ||||||| |||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
10102879 |
tttttgtttgtggtggccggggtttgaaccctggattttgcatgtattatgcattgtcc |
10102821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 197
Target Start/End: Complemental strand, 10213802 - 10213744
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || ||||||| |||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
10213802 |
tttttgtttgtggtggccggggtttgaaccctggattttgcatgtattatgcattgtcc |
10213744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 10926549 - 10926475
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| |||||||||| || ||||||||| | |||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
10926549 |
ttttttttggtggtggccgacatttgaaccccgaaccttgcatatattatgcattgtccttaccaactgagctaa |
10926475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 13800747 - 13800673
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| ||||||||| ||||||| |||| ||||||||||||| |||||||||||| | || ||||||||||| |
|
|
| T |
13800747 |
ttttttttggtggtgtccggggttcgaactgtggaccttgcatatattatgcattgttcttaccaactgagctaa |
13800673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 147 - 213
Target Start/End: Original strand, 17507688 - 17507754
Alignment:
| Q |
147 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||| | ||||| ||| || | |||||||||| ||||||||||||| |||| ||||||||||| |
|
|
| T |
17507688 |
ggtggtggcccgggttcgaatcccgaaccttgcatatattatgcattgtcaatatcaactgagctaa |
17507754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 209
Target Start/End: Complemental strand, 21160131 - 21160062
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||| || |||||||| ||||||||||||| |||||| |||| |||||||||| ||||||| ||||||| |
|
|
| T |
21160131 |
tttttttttgtggtggt-ggggtttgaacccccgaccttacatatattatgcattatccatatcaactgag |
21160062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 147 - 213
Target Start/End: Original strand, 23147967 - 23148033
Alignment:
| Q |
147 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||| |||||||| |||||| |||||| ||||| |||||| ||||||| || ||||||||||| |
|
|
| T |
23147967 |
ggtggtgttcggggttcgaaccccggacctcgcatatattatgtattgtccttaccaactgagctaa |
23148033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 209
Target Start/End: Original strand, 28244085 - 28244155
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||| || |||||| |||||||| |||||| |||||||||||| ||||||||||| |||| ||||||| |
|
|
| T |
28244085 |
tttttttttgtggtgatcggggttcgaaccccggaccttgcatattttatgcattgttcataccaactgag |
28244155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 148 - 214
Target Start/End: Original strand, 44075146 - 44075211
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||||| |||||||||||| | |||||||||||| ||||||||||||| || ||||| ||||||| |
|
|
| T |
44075146 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc-tacaaactaagctaaa |
44075211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 213
Target Start/End: Original strand, 47040887 - 47040949
Alignment:
| Q |
151 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||| | |||||||| | ||||| ||||||||||||||||| ||||| |||||| |||| |
|
|
| T |
47040887 |
gtggtcggagcttgaaccccgaaccttacatacattatgcattgttcatatcaactgaactaa |
47040949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 209
Target Start/End: Original strand, 49975786 - 49975856
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||| || |||||||| | |||||||||| ||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
49975786 |
tttttttttgtggtggttgaagtttgaaccccagaccttgcatatattatgcattgtccataacaactgag |
49975856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 147 - 213
Target Start/End: Complemental strand, 52576019 - 52575953
Alignment:
| Q |
147 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||||| || |||||| ||||||||||| ||||||||||| |||| ||||||||||| |
|
|
| T |
52576019 |
ggtggtggtcgggattcgaaccccagaccttgcatattttatgcattgttcataccaactgagctaa |
52575953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 213
Target Start/End: Complemental strand, 53047848 - 53047786
Alignment:
| Q |
151 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||||||||||| | || ||||||||||||| ||||| |||| ||||||||||| |
|
|
| T |
53047848 |
gtggtcggggtttgaaccccgaactttgcatacattatcaattgttcataccaactgagctaa |
53047786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 147 - 196
Target Start/End: Complemental strand, 11358306 - 11358257
Alignment:
| Q |
147 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
196 |
Q |
| |
|
|||||||| |||||||||||||| ||| |||||||| |||||| |||||| |
|
|
| T |
11358306 |
ggtggtggccggggtttgaaccccggatcttgcatatattatgaattgtc |
11358257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 157 - 214
Target Start/End: Original strand, 13829076 - 13829133
Alignment:
| Q |
157 |
ggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||||| |||||| ||||||||||| |||||||||||||| || |||||||| |||| |
|
|
| T |
13829076 |
ggggttcgaaccccagaccttgcatatattatgcattgtccctaaaaactgagttaaa |
13829133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 164 - 213
Target Start/End: Original strand, 21331423 - 21331472
Alignment:
| Q |
164 |
gaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||| | |||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
21331423 |
gaaccccgaaccttgcatatattatgcattgtccataacaactgagctaa |
21331472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 140 - 209
Target Start/End: Original strand, 25505684 - 25505752
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
|||| ||||||||| || ||||| |||||| ||||||||||| |||||||||||||| || |||||||| |
|
|
| T |
25505684 |
tttttttggtggtg-tccgggttcgaaccccagaccttgcatatattatgcattgtccttacaaactgag |
25505752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 148 - 209
Target Start/End: Complemental strand, 31138487 - 31138427
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||||||||||||||||| ||| || |||||||| ||||||||||||| ||| ||||||| |
|
|
| T |
31138487 |
gtggtggtcggggtttgaa-cctagatcttgcatatattatgcattgtctctatcaactgag |
31138427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 141 - 182
Target Start/End: Original strand, 35210114 - 35210155
Alignment:
| Q |
141 |
tttattggtggtggtcggggtttgaaccctggaccttgcata |
182 |
Q |
| |
|
|||||||||||||| || ||||||||||| |||||||||||| |
|
|
| T |
35210114 |
tttattggtggtggccgaggtttgaaccccggaccttgcata |
35210155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 148 - 213
Target Start/End: Original strand, 35863803 - 35863868
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||| || ||||||||||| ||||||||||| |||||| ||||||| || ||||||||||| |
|
|
| T |
35863803 |
gtggtggccgaggtttgaaccccagaccttgcatatattatgtattgtccttaccaactgagctaa |
35863868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 139 - 211
Target Start/End: Complemental strand, 44582805 - 44582732
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcata-cattatgcattgtccatataaactgagct |
211 |
Q |
| |
|
||||| || ||||||| ||||||| |||||| |||||||||||| ||||||||||| ||||| ||||||||| |
|
|
| T |
44582805 |
tttttttttgtggtggccggggttcgaaccccggaccttgcatattattatgcattgcccataccaactgagct |
44582732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 172 - 213
Target Start/End: Complemental strand, 45096073 - 45096032
Alignment:
| Q |
172 |
gaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
45096073 |
gaccttgcatatattatgcattgtccttatcaactgagctaa |
45096032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 159 - 196
Target Start/End: Original strand, 48656900 - 48656937
Alignment:
| Q |
159 |
ggtttgaaccctggaccttgcatacattatgcattgtc |
196 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
48656900 |
ggtttgaaccccggaccttgcatatattatgcattgtc |
48656937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 148 - 200
Target Start/End: Original strand, 51047159 - 51047212
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcata-cattatgcattgtccata |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||| ||||| ||||||||||| |
|
|
| T |
51047159 |
gtggtggtcggggtttgaaccccggaccttacatattattatacattgtccata |
51047212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 51505919 - 51505878
Alignment:
| Q |
173 |
accttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
51505919 |
accttgcatattttatgcattgtccatatcaactgagctaaa |
51505878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 139 - 200
Target Start/End: Original strand, 54018387 - 54018448
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||| || ||||||| | || ||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
54018387 |
tttttttttgtggtggccaggatttgaaccctgaaccttgcatattttatgcattgtccata |
54018448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 213
Target Start/End: Original strand, 3612169 - 3612237
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| |||| |||||||| ||| ||| ||| |||||||||| ||||||| ||||||||||| |
|
|
| T |
3612169 |
ttggtggtggctggggattgaaccccggagcttatatatattatgcattatccatatcaactgagctaa |
3612237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 213
Target Start/End: Original strand, 4332654 - 4332722
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| |||||||| |||||||||| |||||||| ||| |||||||||| | || | ||||||||||| |
|
|
| T |
4332654 |
ttggtagtggtcggagtttgaaccccggaccttggatatattatgcattattcaaaccaactgagctaa |
4332722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 139 - 195
Target Start/End: Complemental strand, 4825419 - 4825363
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
||||| || |||||||||| |||| |||||| ||||||| |||| |||||||||||| |
|
|
| T |
4825419 |
tttttttttgtggtggtcgaggttcgaaccccggacctttcatatattatgcattgt |
4825363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 195
Target Start/End: Original strand, 5428437 - 5428473
Alignment:
| Q |
159 |
ggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
5428437 |
ggtttgaatcctggaccttgcatatattatgcattgt |
5428473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 209
Target Start/End: Complemental strand, 7651260 - 7651196
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
|||||||||||||| |||||||||| | ||||| ||| | |||||||||||| ||| ||||||| |
|
|
| T |
7651260 |
ttggtggtggtcggcgtttgaaccccgaaccttatatatactatgcattgtccctatcaactgag |
7651196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 197
Target Start/End: Original strand, 14030722 - 14030774
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||| ||||||| |||||| |
|
|
| T |
14030722 |
ttggtggtggtcggggtttgaactccaaaccttgcatatattatgcgttgtcc |
14030774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 137 - 213
Target Start/End: Complemental strand, 15881172 - 15881096
Alignment:
| Q |
137 |
tctttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||| |||||||||| || |||| |||||| | | |||||||| | ||||||||||||||| |||| |||||| |
|
|
| T |
15881172 |
tcttttttttggtggtggccgaggttcgaaccccgaatcttgcatatttaatgcattgtccatatcaacttagctaa |
15881096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 213
Target Start/End: Complemental strand, 17755195 - 17755127
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||||||| ||||||||| | ||||| |||| |||||| ||||| | ||| ||||||||||| |
|
|
| T |
17755195 |
ttggtggtggtcggaatttgaaccccgaaccttacatatattatgtattgttcctatcaactgagctaa |
17755127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 213
Target Start/End: Complemental strand, 19056515 - 19056447
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||||||| ||||||||| | ||||| |||| |||||| ||||| | ||| ||||||||||| |
|
|
| T |
19056515 |
ttggtggtggtcggaatttgaaccccgaaccttacatatattatgtattgttcctatcaactgagctaa |
19056447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 208
Target Start/End: Complemental strand, 20296365 - 20296305
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactga |
208 |
Q |
| |
|
||||| |||||||||||||| |||| ||||||| |||||||||||||||| | |||||| |
|
|
| T |
20296365 |
gtggtcgtcggggtttgaacatcggactttgcatatattatgcattgtccatgttaactga |
20296305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 139 - 195
Target Start/End: Original strand, 20612258 - 20612314
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
||||| ||||| |||| |||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
20612258 |
ttttttttggtagtggccggggtttgaaccccaaaccttgcatatattatgcattgt |
20612314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 213
Target Start/End: Original strand, 21628875 - 21628943
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| |||||||| |||||||||| |||| ||| ||| |||||||||| |||| | ||||||||||| |
|
|
| T |
21628875 |
ttggtagtggtcggagtttgaaccccggacgttggatatattatgcattatccaaaccaactgagctaa |
21628943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 193
Target Start/End: Complemental strand, 31214708 - 31214660
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcatt |
193 |
Q |
| |
|
|||||||||||||| ||||||| || ||||||| |||| |||||||||| |
|
|
| T |
31214708 |
ttggtggtggtcggagtttgaatcccggaccttacatatattatgcatt |
31214660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 137 - 213
Target Start/End: Complemental strand, 32836255 - 32836179
Alignment:
| Q |
137 |
tctttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||| |||||||||| | |||| |||| ||| ||| |||||| |||||||||||||||| ||||||||||| |
|
|
| T |
32836255 |
tcttttttttggtggtggctgaggttcgaactctgaaccgtgcatattttatgcattgtccataccaactgagctaa |
32836179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 213
Target Start/End: Original strand, 35191816 - 35191872
Alignment:
| Q |
157 |
ggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||| |||||| ||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
35191816 |
ggggttcgaaccccagaccttgcatatattatgcattgtccttaccaactgagctaa |
35191872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 213
Target Start/End: Complemental strand, 38894111 - 38894043
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||||| || |||||| |||||||||||| |||| |||||| ||||| ||||||||||| |
|
|
| T |
38894111 |
ttggtggtggtcgaaattcgaaccccggaccttgcatattttatacattgttcatatcaactgagctaa |
38894043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 139 - 214
Target Start/End: Original strand, 39100064 - 39100140
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccct-ggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||| || ||||||| || |||||||||| | |||||||||||| |||||||||||| ||| |||||||||||| |
|
|
| T |
39100064 |
tttttttttgtggtggccgaggtttgaaccatcggaccttgcatatattatgcattgtttataacaactgagctaaa |
39100140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 40575612 - 40575664
Alignment:
| Q |
161 |
tttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||| ||| || |||||||| |
|
|
| T |
40575612 |
tttgaaccccggaccttgcatatattatgcattgtctatactaattgagctaa |
40575664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 139 - 195
Target Start/End: Original strand, 44799036 - 44799092
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
||||| || |||||| |||||||||||||||||||| ||||||| ||||| ||||| |
|
|
| T |
44799036 |
tttttttttgtggtgatcggggtttgaaccctggactttgcatattttatgtattgt |
44799092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 213
Target Start/End: Original strand, 45885468 - 45885532
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||| |||||||| ||||||| ||||||||||| |
|
|
| T |
45885468 |
tggtggccggggtttgaacctcagaccttgcatatattatgcaaggtccataccaactgagctaa |
45885532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 213
Target Start/End: Complemental strand, 46483321 - 46483253
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| |||||| |||| | |||| ||||||| ||||||||||||||||| |||| |||||| |
|
|
| T |
46483321 |
ttggtggtggctggggttcgaactccggactttgcatatattatgcattgtccataccaactaagctaa |
46483253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 196
Target Start/End: Original strand, 48022304 - 48022352
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
196 |
Q |
| |
|
||||||||||| |||||||||| | || ||||||| ||||||||||||| |
|
|
| T |
48022304 |
gtggtggtcggagtttgaaccccgaactttgcatatattatgcattgtc |
48022352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 213
Target Start/End: Original strand, 52453244 - 52453312
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| || |||||||||| | || ||||||| |||||||||||||| ||| |||| |||||| |
|
|
| T |
52453244 |
ttggtggtggacgaggtttgaacctcgaactttgcatatattatgcattgtccctattaactaagctaa |
52453312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 213
Target Start/End: Original strand, 55066587 - 55066655
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| |||| ||||||||| |||| |||||| |||||||||| ||| || ||||||||||| |
|
|
| T |
55066587 |
ttggtggtggccgggatttgaaccccagaccatgcatatattatgcattatccgtaccaactgagctaa |
55066655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 6e-18; HSPs: 110)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 17139498 - 17139572
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |||||||| ||| |||||||||||||| || ||||||||||| |
|
|
| T |
17139498 |
ttttttttggtggtggtcggggtttgaaccccggaccttgaatatattatgcattgtccctaccaactgagctaa |
17139572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 145 - 214
Target Start/End: Original strand, 34521177 - 34521246
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||||||||| || ||||||||||| |||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
34521177 |
ttggtggtggccgaggtttgaaccccggaccttgcatatattatgcattgtccataccaactgagctaaa |
34521246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 1794676 - 1794602
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || |||||||||| ||||||||||| ||| |||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
1794676 |
tttttttttgtggtggtcgaggtttgaaccccggatcttgcatatattatgcattgtccatactaactgagctaa |
1794602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 5907879 - 5907805
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||| |||||||||||||| | ||||||||||| |
|
|
| T |
5907879 |
ttttttttggtggtgtccggggtttgaaccctggaccttgcatatattatgcattgtccttgccaactgagctaa |
5907805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 8269349 - 8269423
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || |||||||||||||||||||||| |||||||||||| |||||| ||||||| || ||||||||||| |
|
|
| T |
8269349 |
tttttttttgtggtggtcggggtttgaaccccggaccttgcatatattatgtattgtccttaccaactgagctaa |
8269423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 18166682 - 18166608
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| ||||| ||||||||||||||||||| |||| ||||||| ||||||||||||| ||| ||||||||||| |
|
|
| T |
18166682 |
ttttttttggtagtggtcggggtttgaaccccggactttgcatatattatgcattgtctataccaactgagctaa |
18166608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 147 - 209
Target Start/End: Complemental strand, 32962635 - 32962573
Alignment:
| Q |
147 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| |||| ||||||| |
|
|
| T |
32962635 |
ggtggtggtcggggtttgaaccctggaccttgcatattttatgcattgttcataccaactgag |
32962573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 139 - 197
Target Start/End: Original strand, 40411734 - 40411792
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
40411734 |
ttttttttcgtggtggtcggggtttgaaccctggaccttacatacattatgtattgtcc |
40411792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 42045353 - 42045427
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| |||||||||| |||||||||||| | ||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
42045353 |
ttttttttggtggtggccggggtttgaactccagaccttgcatatattatgcattgtccataccaactgagctaa |
42045427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 50638897 - 50638971
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| |||||||||| |||| || ||||||||||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
50638897 |
tttttgttggtggtggccgggattcgaaccctggaccttgcatatattatgcattgtccttaccaactgagctaa |
50638971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 148 - 213
Target Start/End: Original strand, 45139996 - 45140061
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||| |||||||| ||| |||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
45139996 |
gtggtggccggggtttaaactctggaccttgcatatattatgcattgtccataccaactgagctaa |
45140061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 145 - 197
Target Start/End: Original strand, 23405345 - 23405397
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||| |||||||||||||| |
|
|
| T |
23405345 |
ttggtggtggtcgggattcgaaccctggaccttgcatatattatgcattgtcc |
23405397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 145 - 197
Target Start/End: Complemental strand, 27533317 - 27533265
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||| |||||||||||||| |
|
|
| T |
27533317 |
ttggtggtggtcggggtttgaaccccgaaccttgcatatattatgcattgtcc |
27533265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 158 - 213
Target Start/End: Original strand, 27449445 - 27449500
Alignment:
| Q |
158 |
gggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||||||| | |||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
27449445 |
gggtttgaaccctgaatcttgcatatattatgcattgtccatattaactgagctaa |
27449500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 139 - 214
Target Start/End: Complemental strand, 44641607 - 44641532
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||| || ||||||| | || ||||||||| || ||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
44641607 |
tttttttttgtggtggccaggatttgaaccccgggccttgcatatattatgcattgtccatatcaactgagctaaa |
44641532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 151 - 209
Target Start/End: Complemental strand, 2994826 - 2994768
Alignment:
| Q |
151 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||| ||||||||||| ||||||| |
|
|
| T |
2994826 |
gtggtcggggtttgaaccccggaccttgcatatattatacattgtccatacgaactgag |
2994768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 148 - 214
Target Start/End: Original strand, 17917128 - 17917194
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||||||||||||||||| || | ||||| |||| ||||||||||||||||| |||||||||||| |
|
|
| T |
17917128 |
gtggtggtcggggtttgaatcccgaaccttacatattttatgcattgtccatatcaactgagctaaa |
17917194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 159 - 213
Target Start/End: Complemental strand, 26755676 - 26755622
Alignment:
| Q |
159 |
ggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||| |||||||||||| || ||||||||||||||| ||||||||||| |
|
|
| T |
26755676 |
ggtttgaaccccggaccttgcatatataatgcattgtccatatcaactgagctaa |
26755622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 32944816 - 32944742
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| |||||||||||||||||| |||||| ||| ||||||| ||||||||||||||||| |||| |||||| |
|
|
| T |
32944816 |
ttttttttggtggtggtcggggttcgaaccccagacgttgcatatattatgcattgtccataccaactaagctaa |
32944742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 156 - 213
Target Start/End: Complemental strand, 25533036 - 25532979
Alignment:
| Q |
156 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||||||| |||||| |||| |
|
|
| T |
25533036 |
cggggtttgaaccccggaccttgcatatattatgcattgtccataccaactgaactaa |
25532979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 148 - 213
Target Start/End: Original strand, 39252247 - 39252312
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||| || |||||||||||||||||| |||| |||||| |||||| |||| ||||||||||| |
|
|
| T |
39252247 |
gtggtggttggagtttgaaccctggaccttacatatattatgtattgtcgatatcaactgagctaa |
39252312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 140 - 213
Target Start/End: Complemental strand, 42888654 - 42888581
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||| |||||||||| |||||| |||||| |||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
42888654 |
tttttttggtggtggcgggggttcgaaccccggaccttgcatattttatgcattgtccataccaactgagctaa |
42888581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 148 - 200
Target Start/End: Complemental strand, 8736506 - 8736454
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
8736506 |
gtggtggccggggtttgaaccccggaccttgcatattttatgcattgtccata |
8736454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 151 - 195
Target Start/End: Original strand, 12268977 - 12269021
Alignment:
| Q |
151 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
12268977 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
12269021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 137 - 197
Target Start/End: Complemental strand, 16307731 - 16307671
Alignment:
| Q |
137 |
tctttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||||| || |||||||||||||||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
16307731 |
tctttttttttgtggtggtcggggtttgatccccagaccttgcatatattatgcattgtcc |
16307671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 213
Target Start/End: Original strand, 26803450 - 26803506
Alignment:
| Q |
157 |
ggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
26803450 |
ggggtttgaaccccggactttgcatatattatgcattgtccataccaactgagctaa |
26803506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 145 - 201
Target Start/End: Original strand, 36467012 - 36467068
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatat |
201 |
Q |
| |
|
||||||||||||||| |||||||| | |||||||||| |||||||||||||||||| |
|
|
| T |
36467012 |
ttggtggtggtcgggatttgaaccttataccttgcatatattatgcattgtccatat |
36467068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 158 - 213
Target Start/End: Complemental strand, 17284012 - 17283957
Alignment:
| Q |
158 |
gggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
17284012 |
gggttcgaaccctggaccttgcatatattatgcattgtccttaccaactgagctaa |
17283957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 140 - 195
Target Start/End: Original strand, 32950743 - 32950798
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
|||| ||||||||||||| ||||||||| | |||||||||||| |||||||||||| |
|
|
| T |
32950743 |
tttttttggtggtggtcgaggtttgaactccggaccttgcatatattatgcattgt |
32950798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 139 - 214
Target Start/End: Original strand, 40734986 - 40735061
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||| || ||||||||| |||||||||||| | ||||| |||| |||||||||||||||| |||||||||||| |
|
|
| T |
40734986 |
tttttttttgtggtggtcagggtttgaaccccgaaccttacatattttatgcattgtccatactaactgagctaaa |
40735061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 139 - 209
Target Start/End: Original strand, 48646706 - 48646777
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcata-cattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||| || ||||||| ||| |||||||||| |||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
48646706 |
tttttttttgtggtggccggagtttgaaccccggaccttgcatattattatgcattgtccatacaaactgag |
48646777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 209
Target Start/End: Complemental strand, 1091259 - 1091189
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||| || ||||||||| | |||||||||| | |||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
1091259 |
tttttttttgtggtggtcagagtttgaaccccgaaccttgcatacattatgcattgtctataccaactgag |
1091189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 197
Target Start/End: Original strand, 8210366 - 8210424
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || ||||||| ||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
8210366 |
tttttttttgtggtggccggggttcgaaccctggaccttgtatatattatgcattgtcc |
8210424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 209
Target Start/End: Original strand, 16033431 - 16033501
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||| || ||||||| ||| |||||||||| ||||||||||| |||||||||||||| ||| ||||||| |
|
|
| T |
16033431 |
tttttttttgtggtggccggagtttgaaccccagaccttgcatatattatgcattgtccctatcaactgag |
16033501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 138 - 196
Target Start/End: Complemental strand, 29506908 - 29506850
Alignment:
| Q |
138 |
ctttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
196 |
Q |
| |
|
|||||| ||||| ||||||||||| ||||||||||||||||||| |||||| |||||| |
|
|
| T |
29506908 |
cttttttttggtcatggtcggggttcgaaccctggaccttgcatatattatgtattgtc |
29506850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 151 - 209
Target Start/End: Complemental strand, 32561041 - 32560983
Alignment:
| Q |
151 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||||||| ||||||||| |||||||||||| ||||| ||||||||||| ||||||| |
|
|
| T |
32561041 |
gtggtcgggatttgaaccccggaccttgcatatattatacattgtccataccaactgag |
32560983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 197
Target Start/End: Complemental strand, 41973335 - 41973277
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || ||||||| ||||||| |||||| |||||||||||| |||||||||||||| |
|
|
| T |
41973335 |
tttttttttgtggtggccggggttcgaaccccggaccttgcatatattatgcattgtcc |
41973277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 148 - 214
Target Start/End: Complemental strand, 44243944 - 44243878
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||||||| ||||||||||| ||||||||| |||| |||||||||||| | || |||||||||||| |
|
|
| T |
44243944 |
gtggtggttggggtttgaactctggaccttacatatattatgcattgttcctaccaactgagctaaa |
44243878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 151 - 212
Target Start/End: Complemental strand, 1755137 - 1755076
Alignment:
| Q |
151 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagcta |
212 |
Q |
| |
|
|||||| |||||||||||| ||||||||||| ||||||| |||||| || ||||||||||| |
|
|
| T |
1755137 |
gtggtcagggtttgaacccgagaccttgcatatattatgcgttgtccctacaaactgagcta |
1755076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 145 - 214
Target Start/End: Complemental strand, 7158847 - 7158778
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||||||||||||||| | ||| | |||||||||||| ||||||||||||||||| ||||| |||||| |
|
|
| T |
7158847 |
ttggtggtggtcggggctcaaactccggaccttgcatattttatgcattgtccatatcaactgggctaaa |
7158778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 148 - 213
Target Start/End: Original strand, 15854078 - 15854143
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||| || |||||||| |||||| |||||||| ||||||||| ||||||| ||||||||||| |
|
|
| T |
15854078 |
gtggtggccgaggtttgaatcctggatcttgcatatattatgcatcgtccataccaactgagctaa |
15854143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 148 - 213
Target Start/End: Original strand, 16967184 - 16967249
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||| ||| ||||||||| | |||||||||| |||||||||||||||||| |||| |||||| |
|
|
| T |
16967184 |
gtggtggccggagtttgaacctcgaaccttgcatatattatgcattgtccatatcaactaagctaa |
16967249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 39966305 - 39966264
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcat |
181 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39966305 |
tttttttggtggtggtcagggtttgaaccctggaccttgcat |
39966264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 148 - 213
Target Start/End: Complemental strand, 40227900 - 40227835
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||||||| |||||| ||||||| ||| |||||||||||||||| ||||||||||| |
|
|
| T |
40227900 |
gtggtggtcggggttcgaaccccagaccttgtatattttatgcattgtccataccaactgagctaa |
40227835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 145 - 214
Target Start/End: Complemental strand, 52043347 - 52043278
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||||||||||||| ||||||||| | || ||||||| ||||||||| |||||| |||||||||||| |
|
|
| T |
52043347 |
ttggtggtggtcgggatttgaaccccgaacattgcatattttatgcattatccataccaactgagctaaa |
52043278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 197
Target Start/End: Original strand, 9929230 - 9929270
Alignment:
| Q |
157 |
ggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
9929230 |
ggggttttaaccctggaccttgcatatattatgcattgtcc |
9929270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 25086541 - 25086489
Alignment:
| Q |
161 |
tttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
25086541 |
tttgaaccctagaccttgcatattttatgcattgtccataccaactgagctaa |
25086489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 145 - 213
Target Start/End: Complemental strand, 29739411 - 29739343
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||| | || ||||||||||| |||||||||||| ||||||||||||| || ||||||||||| |
|
|
| T |
29739411 |
ttggtggtagccgaggtttgaaccccggaccttgcatattttatgcattgtccttaccaactgagctaa |
29739343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 145 - 213
Target Start/End: Original strand, 38448853 - 38448921
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||| |||| || |||||| |||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
38448853 |
ttggtggtgtccgggattcgaaccccggaccttgcatatattatgcattgtccttaccaactgagctaa |
38448921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 39252128 - 39252184
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
196 |
Q |
| |
|
|||| ||||||||||| || |||||||||| |||||||||||| |||||| |||||| |
|
|
| T |
39252128 |
tttttttggtggtggttggagtttgaaccccggaccttgcatatattatgtattgtc |
39252184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 145 - 213
Target Start/End: Original strand, 41769802 - 41769870
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| |||||||| |||||||||| |||||||| ||| |||||||||| |||| | ||||||||||| |
|
|
| T |
41769802 |
ttggtagtggtcggagtttgaaccccggaccttggatatattatgcattatccaaaccaactgagctaa |
41769870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 138 - 214
Target Start/End: Original strand, 41884785 - 41884861
Alignment:
| Q |
138 |
ctttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||||| || ||||||| ||||||| |||||| |||||||| ||| |||||| |||||||| | |||||||||||| |
|
|
| T |
41884785 |
ctttttttttgtggtggccggggttcgaaccccggaccttgtatatattatgtattgtccaaactaactgagctaaa |
41884861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 44678020 - 44678072
Alignment:
| Q |
161 |
tttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||| | |||||||||| ||||||||||||| ||| |||||||||||| |
|
|
| T |
44678020 |
tttgaaccccgaaccttgcatatattatgcattgtctatacaaactgagctaa |
44678072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 137 - 213
Target Start/End: Original strand, 48681912 - 48681988
Alignment:
| Q |
137 |
tctttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||| ||||||||||| |||||| | | | |||||||||| |||||||||||| |||| ||||||||||| |
|
|
| T |
48681912 |
tctttttatatgtggtggtcggagtttgagctccgaaccttgcatatattatgcattgttcataccaactgagctaa |
48681988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 144 - 212
Target Start/End: Complemental strand, 51503754 - 51503686
Alignment:
| Q |
144 |
attggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagcta |
212 |
Q |
| |
|
||||||||||| ||| ||| ||||||| ||||||| ||| |||||||||||||| || |||||||||| |
|
|
| T |
51503754 |
attggtggtggccggcgttcgaaccctagaccttggatatattatgcattgtccctaccaactgagcta |
51503686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 158 - 197
Target Start/End: Original strand, 1887559 - 1887598
Alignment:
| Q |
158 |
gggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
1887559 |
gggtttgaaccctgaactttgcatacattatgcattgtcc |
1887598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 147 - 213
Target Start/End: Complemental strand, 3481633 - 3481566
Alignment:
| Q |
147 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgca-ttgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||| |||||||| |||||| || ||||||||||| |
|
|
| T |
3481633 |
ggtggtggccggggtttgaaccccagaccttgcatatattatgcatttgtccctaccaactgagctaa |
3481566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 3509922 - 3509996
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccct-ggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| |||||||||| || | ||||||||| |||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
3509922 |
ttttttttggtggtggccgag-tttgaacccccggaccttgcatatattatgcattgtccataccaactgagctaa |
3509996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 150 - 193
Target Start/End: Complemental strand, 12212364 - 12212321
Alignment:
| Q |
150 |
ggtggtcggggtttgaaccctggaccttgcatacattatgcatt |
193 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||| |||||||||| |
|
|
| T |
12212364 |
ggtggtcggggtttgaaccccggacgttgcatatattatgcatt |
12212321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 150 - 213
Target Start/End: Complemental strand, 13401666 - 13401603
Alignment:
| Q |
150 |
ggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||||||||||||| | ||||| |||| ||||||||||||| ||| |||||| |||| |
|
|
| T |
13401666 |
ggtggtcggggtttgaaccccgaaccttacatatattatgcattgtctctatcaactgaactaa |
13401603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 149 - 212
Target Start/End: Original strand, 13615603 - 13615666
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagcta |
212 |
Q |
| |
|
||||| |||||||| ||||| |||||||||||| |||||||||||||| || |||||||||| |
|
|
| T |
13615603 |
tggtgttcggggttcgaaccttggaccttgcatgtattatgcattgtccttaccaactgagcta |
13615666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 136 - 195
Target Start/End: Complemental strand, 23203405 - 23203346
Alignment:
| Q |
136 |
gtctttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
|||||||| | ||| ||||||||||||||||||| | |||||||||| ||||||||||| |
|
|
| T |
23203405 |
gtctttttttgggtagtggtcggggtttgaaccccgaaccttgcatattttatgcattgt |
23203346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 147 - 213
Target Start/End: Original strand, 24752636 - 24752703
Alignment:
| Q |
147 |
ggtggtggtcggggtttgaaccctggaccttgcatac-attatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||| ||||||| |||||| ||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
24752636 |
ggtggtggccggggttcgaaccccagaccttgcatattattatgcattgtccataccaactgagctaa |
24752703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 139 - 214
Target Start/End: Original strand, 29233955 - 29234030
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||| || |||||||| |||||| |||||| ||||||||||| |||||||||||| ||| |||||||||||| |
|
|
| T |
29233955 |
tttttttttgtggtggttggggttcgaaccccagaccttgcatattttatgcattgtctataccaactgagctaaa |
29234030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 144 - 195
Target Start/End: Original strand, 37045132 - 37045183
Alignment:
| Q |
144 |
attggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
37045132 |
attggtggtgtctggggttcgaaccctggaccttgcatatattatgcattgt |
37045183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 138 - 213
Target Start/End: Original strand, 47528427 - 47528502
Alignment:
| Q |
138 |
ctttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||| ||||||||| ||||||| ||||| ||||||||| || |||||||||||||| || ||||||||||| |
|
|
| T |
47528427 |
cttttttttggtggtgtccggggttcgaacctcggaccttgcgtatattatgcattgtccttaccaactgagctaa |
47528502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 158 - 213
Target Start/End: Complemental strand, 50040417 - 50040362
Alignment:
| Q |
158 |
gggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| | ||||||||||| |
|
|
| T |
50040417 |
gggtttgaaccctggaccttgcatattttatgcattgtcccaaccaactgagctaa |
50040362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 213
Target Start/End: Complemental strand, 1605456 - 1605402
Alignment:
| Q |
159 |
ggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||| |||| |||||| |
|
|
| T |
1605456 |
ggtttgaaccccggaccttgcatattttatgcattgtccatactaactaagctaa |
1605402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 213
Target Start/End: Complemental strand, 2613790 - 2613728
Alignment:
| Q |
151 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||||| |||||| | ||||| |||| |||||||||||||||| ||||||||||| |
|
|
| T |
2613790 |
gtggtcggggttcgaaccccgaaccttacatattttatgcattgtccataccaactgagctaa |
2613728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 213
Target Start/End: Original strand, 3693789 - 3693851
Alignment:
| Q |
151 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||||||||||| |||||| |||| ||||||| ||||| |||| ||||||||||| |
|
|
| T |
3693789 |
gtggtcggggtttgaacctcagaccttacatatattatgctttgtctatatcaactgagctaa |
3693851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 197
Target Start/End: Original strand, 6000124 - 6000182
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || |||||| ||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
6000124 |
tttttttttgtggtgtccggggtttgaacctcggaccttgcatatattatgcattgtcc |
6000182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 197
Target Start/End: Complemental strand, 11702046 - 11701988
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| ||||| |||||| ||||||| |||||||||||| |||| ||||||||||||| |
|
|
| T |
11702046 |
ttttttttggtagtggtcagggtttgcaccctggaccttacatattttatgcattgtcc |
11701988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 197
Target Start/End: Complemental strand, 21638193 - 21638135
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| ||||||||| ||||||| |||||| |||||||||||| || ||||||||||| |
|
|
| T |
21638193 |
ttttttttggtggtgtccggggttcgaaccccggaccttgcatatatcatgcattgtcc |
21638135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 214
Target Start/End: Complemental strand, 28006809 - 28006747
Alignment:
| Q |
152 |
tggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||||||||||| ||| | |||| ||||||| ||||||||||||| |||| ||||||| |||| |
|
|
| T |
28006809 |
tggtcggggtttaaactccggactttgcatatattatgcattgtctatattaactgagttaaa |
28006747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 197
Target Start/End: Original strand, 33153861 - 33153919
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || |||||| |||||||||||||| ||||||| |||| |||||||||||||| |
|
|
| T |
33153861 |
tttttttttgtggtgttcggggtttgaacctcggaccttacatatattatgcattgtcc |
33153919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 193
Target Start/End: Complemental strand, 34595952 - 34595898
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcatt |
193 |
Q |
| |
|
||||| || ||||||| || ||||||||||| |||||||||||| |||||||||| |
|
|
| T |
34595952 |
tttttttttgtggtggccgaggtttgaaccccggaccttgcatatattatgcatt |
34595898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 197
Target Start/End: Complemental strand, 35011473 - 35011415
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || |||||| ||||| |||||||| || |||||||||| |||||||||||||| |
|
|
| T |
35011473 |
ttttttttagtggtgttcgggttttgaaccttgaaccttgcatatattatgcattgtcc |
35011415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 197
Target Start/End: Complemental strand, 40613103 - 40613045
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || |||||||||| | || |||||| |||||||||||| |||||||||||||| |
|
|
| T |
40613103 |
tttttttttgtggtggtcgagattcgaaccccggaccttgcatatattatgcattgtcc |
40613045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 213
Target Start/End: Original strand, 41763148 - 41763210
Alignment:
| Q |
151 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||| |||||||||||||| |||||||||||| ||||||||| ||| || ||||||||||| |
|
|
| T |
41763148 |
gtggccggggtttgaaccccggaccttgcatattttatgcattatccctaccaactgagctaa |
41763210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 197
Target Start/End: Complemental strand, 43356515 - 43356457
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| ||||||||||||||||||||||| | ||||| |||| |||||||||||||| |
|
|
| T |
43356515 |
tttttcttggtggtggtcggggtttgaactccaaaccttacatatattatgcattgtcc |
43356457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 44860864 - 44860938
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| ||||| |||| |||||||||||||| ||||||| ||| |||||||||||||| | ||||||||||| |
|
|
| T |
44860864 |
ttttttttggtagtggccggggtttgaaccccagaccttggatattttatgcattgtccaaaccaactgagctaa |
44860938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 193
Target Start/End: Original strand, 49431974 - 49432028
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcatt |
193 |
Q |
| |
|
||||| || ||||||| |||||||||||||| ||||||| |||| |||||||||| |
|
|
| T |
49431974 |
tttttttttgtggtggccggggtttgaaccccggaccttacatatattatgcatt |
49432028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 147 - 213
Target Start/End: Original strand, 52441500 - 52441566
Alignment:
| Q |
147 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||| ||||||| ||| | |||||||||||| ||||||||||||| ||| ||||||||||| |
|
|
| T |
52441500 |
ggtggtggccggggttcaaacgccggaccttgcatatattatgcattgtctataccaactgagctaa |
52441566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 140 - 197
Target Start/End: Original strand, 64660 - 64717
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
|||| |||||||||| || ||||||||| | |||| ||||||| |||||||||||||| |
|
|
| T |
64660 |
tttttttggtggtggacgaggtttgaactccggactttgcatatattatgcattgtcc |
64717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 3393583 - 3393624
Alignment:
| Q |
173 |
accttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||||||||| |||||||||||| ||||| |||||||||||| |
|
|
| T |
3393583 |
accttgcatatattatgcattgttcatatcaactgagctaaa |
3393624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 139 - 196
Target Start/End: Complemental strand, 5280711 - 5280654
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
196 |
Q |
| |
|
||||| || ||||||||||||||| |||||| ||||||||||| |||||||| |||| |
|
|
| T |
5280711 |
tttttgtttgtggtggtcggggttcgaaccccagaccttgcatatattatgcactgtc |
5280654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 145 - 214
Target Start/End: Complemental strand, 7732496 - 7732427
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||| |||||||| ||||||| || ||| |||| ||| |||||||||| |||| || |||||||||||| |
|
|
| T |
7732496 |
ttggtagtggtcggagtttgaatcccggatcttggatatattatgcattatccaaatcaactgagctaaa |
7732427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 148 - 209
Target Start/End: Complemental strand, 10293007 - 10292946
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
|||||||||||||||| ||||| | |||| |||| |||||||||||||| ||| ||||||| |
|
|
| T |
10293007 |
gtggtggtcggggtttaaaccccgtcccttacatatattatgcattgtccctatcaactgag |
10292946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 148 - 209
Target Start/End: Original strand, 10356173 - 10356234
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||||| ||| ||| |||||| ||||| |||||| ||||||||||||||||| ||||||| |
|
|
| T |
10356173 |
gtggtggccggagttcgaaccccggaccgtgcatatattatgcattgtccataccaactgag |
10356234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 139 - 200
Target Start/End: Original strand, 11181916 - 11181977
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
||||| || ||||||| |||||||||||||| | |||||||||| | |||||||||||||| |
|
|
| T |
11181916 |
tttttttttgtggtggccggggtttgaaccccgcaccttgcatatttcatgcattgtccata |
11181977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 149 - 213
Target Start/End: Original strand, 15549227 - 15549292
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatac-attatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||| ||||||||||||| |||| ||||||||||| |
|
|
| T |
15549227 |
tggtggtcggggattgaactttagaccttgcatattattatgcattgtctatatcaactgagctaa |
15549292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 140 - 213
Target Start/End: Original strand, 21400006 - 21400078
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||| ||||||||| || ||||| |||||| ||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
21400006 |
tttttttggtggtg-tcagggttcgaacccaagaccttgcatatattatgcattgtccctaccaactgagctaa |
21400078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 139 - 212
Target Start/End: Original strand, 24740821 - 24740894
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagcta |
212 |
Q |
| |
|
||||| || ||||||| ||||||||||||| ||| ||||||||||| || |||||||| || |||||||||| |
|
|
| T |
24740821 |
tttttttttgtggtggctggggtttgaaccccggatcttgcatacatcatacattgtccctaccaactgagcta |
24740894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 148 - 209
Target Start/End: Original strand, 28832161 - 28832222
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| |||||||||||| |||| ||||||| |
|
|
| T |
28832161 |
gtggtggtcgggatttgaacctcagaccttgcatatattatgcattgttcataccaactgag |
28832222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 158 - 195
Target Start/End: Original strand, 32497481 - 32497518
Alignment:
| Q |
158 |
gggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
32497481 |
gggtttgaaccctagaccttgcatatattatgcattgt |
32497518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 139 - 192
Target Start/End: Original strand, 46149025 - 46149078
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcat |
192 |
Q |
| |
|
||||| || ||||||| ||||||||||||| ||||||||||||| | ||||||| |
|
|
| T |
46149025 |
tttttttttgtggtggccggggtttgaaccttggaccttgcatataatatgcat |
46149078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 145 - 198
Target Start/End: Complemental strand, 46392307 - 46392254
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcca |
198 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||| ||| |||||||||| |||| |
|
|
| T |
46392307 |
ttggtggtggtcggaatttgaaccccggaccttggatatattatgcattatcca |
46392254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 140 - 213
Target Start/End: Complemental strand, 48100801 - 48100728
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||| ||| |||||||| ||||||||||| |||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
48100801 |
tttttttgatggtggtcaaggtttgaaccccaaaccttgcatattttatgcattgtccataccaactgagctaa |
48100728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 209
Target Start/End: Complemental strand, 3777792 - 3777728
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||||||||||| |||||||||| | |||||| ||| ||||| |||| ||||||| ||||||| |
|
|
| T |
3777792 |
ttggtggtggtcgaggtttgaacctcgaaccttgtatatattatacattatccatatcaactgag |
3777728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 196
Target Start/End: Original strand, 7454568 - 7454616
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
196 |
Q |
| |
|
||||||||||||||||||| | || |||||||||| ||||| ||||||| |
|
|
| T |
7454568 |
gtggtggtcggggtttgaatcatgaaccttgcatatattatacattgtc |
7454616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 213
Target Start/End: Complemental strand, 8253785 - 8253745
Alignment:
| Q |
173 |
accttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
8253785 |
accttgcatatattatgcattgtccataccaactgagctaa |
8253745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 209
Target Start/End: Original strand, 8266201 - 8266237
Alignment:
| Q |
173 |
accttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8266201 |
accttgcatacattatgcattgtccataccaactgag |
8266237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 197
Target Start/End: Complemental strand, 9005753 - 9005701
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||||||||| ||||||||||||| |||||| |||| |||||| ||||||| |
|
|
| T |
9005753 |
ttggtggtggttggggtttgaacccatgaccttccatatattatgtattgtcc |
9005701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 193
Target Start/End: Original strand, 10356702 - 10356749
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcatt |
193 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||| |||||||||| |
|
|
| T |
10356702 |
ttggtggtggtcggg-tttgaaccccagaccttgcatatattatgcatt |
10356749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 213
Target Start/End: Complemental strand, 12214062 - 12213999
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||| |||||| ||||| | ||| ||||||||||| |
|
|
| T |
12214062 |
tggtggtcggggtt-gaaccccagaccttgcatatattatgtattgttcctatcaactgagctaa |
12213999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 19620634 - 19620582
Alignment:
| Q |
161 |
tttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||||| |||||||||||| |||||| ||||||| || ||||||||||| |
|
|
| T |
19620634 |
tttgaaccccggaccttgcatatattatgtattgtccttaccaactgagctaa |
19620582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 22335428 - 22335380
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| |||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
22335428 |
tggtgttcggggtttgaacctcagaccttgcatatattatgcattgtcc |
22335380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 147 - 195
Target Start/End: Original strand, 24571614 - 24571662
Alignment:
| Q |
147 |
ggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||| |||||| ||||| |
|
|
| T |
24571614 |
ggtggtggtcggagtttgaaccccagaccttgcatatattatgtattgt |
24571662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 43545832 - 43545888
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
196 |
Q |
| |
|
|||| ||||||||||||| |||| |||||| ||||||||||| |||||||||||| |
|
|
| T |
43545832 |
tttttttggtggtggtcgaggttcgaacccgtgaccttgcatattttatgcattgtc |
43545888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 214
Target Start/End: Complemental strand, 43611489 - 43611429
Alignment:
| Q |
154 |
gtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||||||||||||||| ||||| |||| |||||| |||||||||| |||||||||||| |
|
|
| T |
43611489 |
gtcggggtttgaaccccataccttacatatattatgtattgtccataccaactgagctaaa |
43611429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0027 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 145 - 193
Target Start/End: Original strand, 61557 - 61605
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcatt |
193 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
61557 |
ttggtggtggccggggtttgaaccctggaccttacatacattatgcatt |
61605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 145 - 209
Target Start/End: Complemental strand, 161215 - 161151
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||| |||||||||||||||| ||||||| |
|
|
| T |
161215 |
ttggtggtggtcggggtttgaaccccgaaccttgcatattttatgcattgtccataccaactgag |
161151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0180 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: scaffold0180
Description:
Target: scaffold0180; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 139 - 214
Target Start/End: Complemental strand, 17811 - 17737
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||| |||||||||| ||||||||||||| ||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
17811 |
ttttttttggtggtggctggggtttgaaccc-ggaccttgcatgtattatgcattgtccataccaactgagctaaa |
17737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1694 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold1694
Description:
Target: scaffold1694; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 159 - 213
Target Start/End: Complemental strand, 215 - 161
Alignment:
| Q |
159 |
ggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
215 |
ggtttgaacctcagaccttgcatacattatgcattgtccatatcaactgagctaa |
161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0143 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0143
Description:
Target: scaffold0143; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 156 - 214
Target Start/End: Complemental strand, 4529 - 4471
Alignment:
| Q |
156 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||| ||| |||| ||||||| |
|
|
| T |
4529 |
cgggatttgaaccctggaccttgcataaattatgcattgtccctatcaactaagctaaa |
4471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0735 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0735
Description:
Target: scaffold0735; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 140 - 213
Target Start/End: Complemental strand, 1607 - 1534
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||| |||||||||| |||||| |||||| |||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
1607 |
tttttttggtggtggcgggggttcgaaccccggaccttgcatattttatgcattgtccataccaactgagctaa |
1534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0040 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: scaffold0040
Description:
Target: scaffold0040; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 137 - 213
Target Start/End: Complemental strand, 58936 - 58859
Alignment:
| Q |
137 |
tctttttattggtggtgg-tcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||| |||||||||| ||||||||| |||| |||||||| |||||||||||||| |||||| ||||||||||| |
|
|
| T |
58936 |
tcttttttttggtggtgggtcggggtttaaacctcggaccttgtatacattatgcattatccataccaactgagctaa |
58859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0040; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 213
Target Start/End: Complemental strand, 56863 - 56790
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||| || ||||||| |||||||||| | ||||||||||||| ||||| ||||||||||| ||||||||||| |
|
|
| T |
56863 |
tttttttttgtggtggctggggtttgaaac-tggaccttgcatatattatacattgtccataccaactgagctaa |
56790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 213
Target Start/End: Original strand, 72771 - 72831
Alignment:
| Q |
154 |
gtcggggtttgaaccctggaccttgcatacattatgcattgt-ccatataaactgagctaa |
213 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||| |||||| |||||| |||| |
|
|
| T |
72771 |
gtcggagtttgaaccctggaccttgcatatattatgcattgtcccatatcaactgaactaa |
72831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0334 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0334
Description:
Target: scaffold0334; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 139 - 214
Target Start/End: Complemental strand, 5262 - 5187
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||| || |||||||| |||||||||||| ||||||||||| ||||||||||||||||| || ||||||||| |
|
|
| T |
5262 |
tttttttttgtggtggttggggtttgaacctcagaccttgcatatattatgcattgtccataccaattgagctaaa |
5187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0188 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0188
Description:
Target: scaffold0188; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 151 - 214
Target Start/End: Original strand, 28106 - 28169
Alignment:
| Q |
151 |
gtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||| ||||||||||| || |||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
28106 |
gtggccggggtttgaatcccagaccttgcatacgttatgcattgtccataccaactgagctaaa |
28169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 139 - 210
Target Start/End: Original strand, 31903 - 31974
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagc |
210 |
Q |
| |
|
||||| || ||||||| ||| || ||||||| |||||||||||| |||||||||||||| ||| |||||||| |
|
|
| T |
31903 |
tttttttttgtggtggccggagtgtgaaccccggaccttgcatatattatgcattgtccctatcaactgagc |
31974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 149 - 200
Target Start/End: Complemental strand, 64288 - 64237
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccata |
200 |
Q |
| |
|
|||||||||||||| ||| || |||||||||||| ||||||||||||||||| |
|
|
| T |
64288 |
tggtggtcggggttcgaatcccggaccttgcatatattatgcattgtccata |
64237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0259 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0259
Description:
Target: scaffold0259; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 140 - 214
Target Start/End: Complemental strand, 5492 - 5418
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||| |||||||||||||||| | |||||| ||||||||||| |||||||||||||||| ||| |||||||| |
|
|
| T |
5492 |
tttttttggtggtggtcggggatcgaaccccagaccttgcatattttatgcattgtccataccaaccgagctaaa |
5418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 197
Target Start/End: Original strand, 53361 - 53419
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || |||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
53361 |
tttttttttgtggtggtcggggtttgaaccccagaccttgcatattttatgcattgtcc |
53419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 35; Significance: 0.00000000008; HSPs: 2)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 209
Target Start/End: Complemental strand, 7802 - 7732
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||| || ||||||||||||||||||||| ||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
7802 |
tttttttttgtggtggtcggggtttgaacctcggaccttgcatgttttatgcattgtccataccaactgag |
7732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 156 - 213
Target Start/End: Complemental strand, 185326 - 185269
Alignment:
| Q |
156 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||||||| ||| |||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
185326 |
cggggtttgaaccccggatcttgcatattttatgcattgtccataccaactgagctaa |
185269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 148 - 214
Target Start/End: Original strand, 221003 - 221069
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||| |||||| ||| ||| || |||||||||||| |
|
|
| T |
221003 |
gtggtggtcggggtttgaaccctagactttgcatatattatgtattatccctaccaactgagctaaa |
221069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0350 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0350
Description:
Target: scaffold0350; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 148 - 213
Target Start/End: Complemental strand, 1319 - 1254
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
||||||| ||| |||||||| | |||||| |||| |||||||||||||||||| ||||||||||| |
|
|
| T |
1319 |
gtggtggccggagtttgaactccagaccttacatatattatgcattgtccatatcaactgagctaa |
1254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0238 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0238
Description:
Target: scaffold0238; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 140 - 197
Target Start/End: Complemental strand, 25468 - 25411
Alignment:
| Q |
140 |
ttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
|||| ||||||||| |||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
25468 |
tttttttggtggtgtctggggttcgaaccctggaccttgcatatattatgcattgtcc |
25411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 148 - 209
Target Start/End: Complemental strand, 99108 - 99047
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgag |
209 |
Q |
| |
|
||||| ||||| |||||||||| ||||||||||| |||||||||||||| ||| ||||||| |
|
|
| T |
99108 |
gtggttgtcggagtttgaaccccagaccttgcatatattatgcattgtccctatcaactgag |
99047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 139 - 211
Target Start/End: Complemental strand, 75405 - 75333
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagct |
211 |
Q |
| |
|
||||| || ||||||| |||| || |||||| |||||||||||| |||||||||||||| || ||||||||| |
|
|
| T |
75405 |
tttttttttgtggtggccgggattcgaaccccggaccttgcatatattatgcattgtccttaccaactgagct |
75333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0035 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0035
Description:
Target: scaffold0035; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 149 - 196
Target Start/End: Original strand, 73511 - 73558
Alignment:
| Q |
149 |
tggtggtcggggtttgaaccctggaccttgcatacattatgcattgtc |
196 |
Q |
| |
|
|||||||||| |||||||||| |||| ||||||||| ||||||||||| |
|
|
| T |
73511 |
tggtggtcggagtttgaaccccggacattgcatacactatgcattgtc |
73558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1127 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold1127
Description:
Target: scaffold1127; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 195
Target Start/End: Original strand, 1164 - 1202
Alignment:
| Q |
157 |
ggggtttgaaccctggaccttgcatacattatgcattgt |
195 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
1164 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
1202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0122
Description:
Target: scaffold0122; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 148 - 214
Target Start/End: Original strand, 14176 - 14242
Alignment:
| Q |
148 |
gtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||| |||| ||||||| |||| |
|
|
| T |
14176 |
gtggtggtcggggtttgaaccacataccttgcatatattatgcattgttcataccaactgagttaaa |
14242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0081 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0081
Description:
Target: scaffold0081; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 197
Target Start/End: Complemental strand, 9034 - 8976
Alignment:
| Q |
139 |
tttttattggtggtggtcggggtttgaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||| || |||||| |||||||||||| || | || |||||||||||||||||||||| |
|
|
| T |
9034 |
tttttttttgtggtgttcggggtttgaatcccgaactttgcatacattatgcattgtcc |
8976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 156 - 214
Target Start/End: Complemental strand, 239870 - 239812
Alignment:
| Q |
156 |
cggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
|||||||||||| | |||| ||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
239870 |
cggggtttgaactccggactttgcatatattatgcattgtccttaccaactgagctaaa |
239812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0126 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0126
Description:
Target: scaffold0126; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 164 - 197
Target Start/End: Original strand, 34894 - 34927
Alignment:
| Q |
164 |
gaaccctggaccttgcatacattatgcattgtcc |
197 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
34894 |
gaaccctggaccttgcatatattatgcattgtcc |
34927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0071 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0071
Description:
Target: scaffold0071; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 145 - 182
Target Start/End: Complemental strand, 53499 - 53462
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcata |
182 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||| |
|
|
| T |
53499 |
ttggtggtggtcggggtttgaatcccggaccttgcata |
53462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 145 - 182
Target Start/End: Original strand, 354627 - 354664
Alignment:
| Q |
145 |
ttggtggtggtcggggtttgaaccctggaccttgcata |
182 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
354627 |
ttggtggtggtcggggtttgaaccctaaaccttgcata |
354664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0118 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0118
Description:
Target: scaffold0118; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 213
Target Start/End: Complemental strand, 40044 - 40004
Alignment:
| Q |
173 |
accttgcatacattatgcattgtccatataaactgagctaa |
213 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
40044 |
accttgcatatattatgcattgtccataccaactgagctaa |
40004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0087 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0087
Description:
Target: scaffold0087; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 214
Target Start/End: Original strand, 44759 - 44819
Alignment:
| Q |
154 |
gtcggggtttgaaccctggaccttgcatacattatgcattgtccatataaactgagctaaa |
214 |
Q |
| |
|
||||| ||||||||||| ||||||||||| ||| | ||||| ||||| |||||||||||| |
|
|
| T |
44759 |
gtcggagtttgaaccctagaccttgcatattttaagaattgtacatattaactgagctaaa |
44819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University