View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11847_high_21 (Length: 236)
Name: NF11847_high_21
Description: NF11847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11847_high_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 15 - 217
Target Start/End: Original strand, 35684868 - 35685070
Alignment:
| Q |
15 |
aggttttgcagtttaccttggcagatgtgagtcaggctatatgtgtttctcatacaagtaaggagaacacggttttgaggtcgggtttggcgccggagaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35684868 |
aggttttgcagtttaccttggcagatgtgagtcaggctatatgtgtttctcatacaagtaaggagaacacggttttgaggtcgggtttggcgccggagaa |
35684967 |
T |
|
| Q |
115 |
ggtttttgtaatacctaatgctgttgacactgccaagtttaagccaatgtcggaggaggagcgccgtagttctaaacctagtagatccgaaattgttatt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35684968 |
ggtttttgtaatacctaatgctgttgacactgccaagtttaagccaatgtcggaggaggagcgccgtagttctaaacctagtagatccgaaattgttatt |
35685067 |
T |
|
| Q |
215 |
gtt |
217 |
Q |
| |
|
||| |
|
|
| T |
35685068 |
gtt |
35685070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 15 - 141
Target Start/End: Complemental strand, 40672274 - 40672148
Alignment:
| Q |
15 |
aggttttgcagtttaccttggcagatgtgagtcaggctatatgtgtttctcatacaagtaaggagaacacggttttgaggtcgggtttggcgccggagaa |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||| || |||||||||||||| ||||| ||||| ||||| || || |||| |||||| | || || || |
|
|
| T |
40672274 |
aggtgttgcagtttaccttggcagatgtgactcaagccatatgtgtttctcacacaagcaaggaaaacacagtgttacggtcaggtttgccaccagataa |
40672175 |
T |
|
| Q |
115 |
ggtttttgtaatacctaatgctgttga |
141 |
Q |
| |
|
|||||||||||||||||||| ||||| |
|
|
| T |
40672174 |
agtttttgtaatacctaatgccgttga |
40672148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University