View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11847_low_12 (Length: 373)
Name: NF11847_low_12
Description: NF11847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11847_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 184 - 356
Target Start/End: Original strand, 37100765 - 37100937
Alignment:
| Q |
184 |
aacatcaacaacacaagcaagcataacagttacaatagtactactagtagtgaagtgttgtgttgtgttaattgcaggtggagacagagagagggtagat |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37100765 |
aacatcaacaacacaagcaagcataacagttacagtagtactactagtagtgaagtgttgtgttgtgttaattgcaggtggagacagagagagggtagat |
37100864 |
T |
|
| Q |
284 |
aaagagttaacgtgtgtctctgcaacttaactcagagttttccttcccaatgaaatgaaaatgaatctcactg |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37100865 |
aaagagttaacgtgtgtctctgcaacttaactcagagttttccttcccaatgaaatgaaaatgaatctcactg |
37100937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 23 - 162
Target Start/End: Original strand, 37100598 - 37100741
Alignment:
| Q |
23 |
agaagcatagggatttttggggttcttggaaagtataataatct----gtaaaaggtggaatcagattcatcttatgcaaaatgagtagtagtgtagtct |
118 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37100598 |
agaagaatagggatttttggggttcttggaaagtataataatctatctgtaaaaggtggaatcagattcatcttatgcaaaatgagtagtagtgtagtct |
37100697 |
T |
|
| Q |
119 |
ttctttcatctttctgttgtgtacatcaaacaaatcaaatagtt |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37100698 |
ttctttcatctttctgttgtgtacatcaaacaaatcaaatagtt |
37100741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University