View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11847_low_16 (Length: 301)
Name: NF11847_low_16
Description: NF11847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11847_low_16 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 79 - 301
Target Start/End: Complemental strand, 34635330 - 34635109
Alignment:
| Q |
79 |
ctttgaacaacttataaaaataagtcgaaaaatatagttcaaggagaaatcattatatgtttctttaagctcataaatgtctagattagtggataatctc |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34635330 |
ctttgaacaacttataaaaataagtcgaaaaatatagttcaaggagaaatcattatatgtttctttaggctcataaatgtctagattagtggataatctc |
34635231 |
T |
|
| Q |
179 |
aaagattcaaacggnnnnnnnnnnaaggattcaaacagtatttttgatattgtgtaaatccagcaatgtaattaagattttaaattgcggttgtgagaaa |
278 |
Q |
| |
|
|||||||||||| | |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34635230 |
aaagattcaaacagtttttttttaaaggattcaaacagta-ttttgatattgtgtaaatccagcaatgtaattaagattttaaattgcggttgtgagaaa |
34635132 |
T |
|
| Q |
279 |
tgaagtaggtgtaatatggttac |
301 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
34635131 |
tgaagtaggtgtaatatggttac |
34635109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University