View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11848_high_5 (Length: 305)

Name: NF11848_high_5
Description: NF11848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11848_high_5
NF11848_high_5
[»] chr6 (1 HSPs)
chr6 (250-299)||(5638054-5638103)


Alignment Details
Target: chr6 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 250 - 299
Target Start/End: Complemental strand, 5638103 - 5638054
Alignment:
250 tagcaactcaaattatacaaactttgtgcatgcaagtcaattcatctcac 299  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
5638103 tagcaactcaaattatacaaactttgtgcatgcaagtcaattcatctcac 5638054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University