View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11848_low_5 (Length: 305)
Name: NF11848_low_5
Description: NF11848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11848_low_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 250 - 299
Target Start/End: Complemental strand, 5638103 - 5638054
Alignment:
| Q |
250 |
tagcaactcaaattatacaaactttgtgcatgcaagtcaattcatctcac |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5638103 |
tagcaactcaaattatacaaactttgtgcatgcaagtcaattcatctcac |
5638054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University