View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11848_low_7 (Length: 286)
Name: NF11848_low_7
Description: NF11848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11848_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 27 - 269
Target Start/End: Original strand, 40399593 - 40399838
Alignment:
| Q |
27 |
ttgaaaacatgattctcccatttggctcttgtttttggcacctcatggctccctaaaatcacattttaatatgtgtaacataccataacaacaaaaaact |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40399593 |
ttgaaaacatgattctcccatttggctcttgtttttggcacctcatggctccctaaaatcacattttaatatgtgtaacataccataacaacaaaaaact |
40399692 |
T |
|
| Q |
127 |
cttcaactaacaaccaaatagaaaaaacatagtcattgcaa---atcatcatcacacatgatatagcgtgacaaaattccactatgaatccatttgagta |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40399693 |
cttcaactaacaaccaaatagaaaaaacatagtcattgcaaatcatcatcatcacacatgatatagcgtgacaaaattccactatgaatccatttgagta |
40399792 |
T |
|
| Q |
224 |
gtctttcttttcattcctttctcacacacctttttcttgcaattta |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40399793 |
gtctttcttttcattcctttctcacacacctttttcttgcaattta |
40399838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University