View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11849_high_24 (Length: 303)
Name: NF11849_high_24
Description: NF11849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11849_high_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 148 - 270
Target Start/End: Original strand, 32875786 - 32875908
Alignment:
| Q |
148 |
agatgcagaaaatcgttttactgttctataataaccggttgtagcttttatcgttattctgcagatttgattcttgtttggttaaaataagcatcggata |
247 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32875786 |
agatgcagaaaatcgttttacagtactataataaccggttgtagcttttatcgttattctgcagatttgattcttgtttggttaaaataagcatcggata |
32875885 |
T |
 |
| Q |
248 |
aagtttagttcagtcattttcac |
270 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
32875886 |
aagtttagttcagtcattttcac |
32875908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 21 - 86
Target Start/End: Original strand, 32875659 - 32875724
Alignment:
| Q |
21 |
gaccattctctgtttcgttactttttggttcaattatatgatatgttatgtgcctcgaatagatcg |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32875659 |
gaccattctctgtttcgttactttttggttcaattatatgatatgttatgtgcctcgaatagatcg |
32875724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University