View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11849_high_30 (Length: 232)
Name: NF11849_high_30
Description: NF11849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11849_high_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 16 - 214
Target Start/End: Original strand, 11156658 - 11156858
Alignment:
| Q |
16 |
aagaaagtataaaataaggttcatgtgctttcaattatcttactctttttattgtttacccacacctacccccataaactag--tgtatgtattttttca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||| |||||||||||| |
|
|
| T |
11156658 |
aagaaagtataaaataaggttcatgtgctttcaattatcttactctttttattgtttacccacacctacccccacaaactagagtgtttgtattttttca |
11156757 |
T |
 |
| Q |
114 |
ctcttacnnnnnnnggtcgatatatatagtgccttacccttgcaaagggtacagaagaaagtgaaagtagatgaggattcggaaaaacacaaagctttcc |
213 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11156758 |
atcttacaaaaaaaggtcgatatatatagtgccttacccttgcaaagggtacagaagaaagtgaaagtagatgaggattcggaaaaacacaaagctttcc |
11156857 |
T |
 |
| Q |
214 |
c |
214 |
Q |
| |
|
| |
|
|
| T |
11156858 |
c |
11156858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 16 - 84
Target Start/End: Original strand, 11174971 - 11175039
Alignment:
| Q |
16 |
aagaaagtataaaataaggttcatgtgctttcaattatcttactctttttattgtttacccacacctac |
84 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
11174971 |
aagaaagcataaaataaggtttatgtgctttcaattatcttaatctttttagtgtttacccacacctac |
11175039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University