View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11849_high_9 (Length: 439)
Name: NF11849_high_9
Description: NF11849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11849_high_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 422; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 422; E-Value: 0
Query Start/End: Original strand, 1 - 426
Target Start/End: Complemental strand, 51822027 - 51821602
Alignment:
| Q |
1 |
cattccagaaggtattggtcaacttcaacaacttggtaacctgcatttgcagggtaacaagttaacaggggtaattccggagtctttaggttattgtaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51822027 |
cattccagaaggtattggtcaacttcaacaacttggtaacctgcatttgcagggtaacaagttaacaggggtaattccggagtctttaggttattgtaac |
51821928 |
T |
|
| Q |
101 |
tcactcaacgacgttgatctttcgagaaatgaactctcgaaagatattccttcttccttgggtttgttaccggctttaaattctctgaatttctcagaga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51821927 |
tcactcaacgacgttgatctttcgagaaatgaactctcgaaagatattccttcgtccttgggtttgttaccggctttaaattctctgaatttctcagaga |
51821828 |
T |
|
| Q |
201 |
atgaactttccggtaaaataccagagagtttaggttcattgaagttgagtctctttgatctttcgcataaccgattatccggtgaaattccaataggttt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51821827 |
atgaactttccggtaaaataccagagagtttaggttcattgaagttgagtctctttgatctttcgcataaccgattatccggtgaaattccaataggttt |
51821728 |
T |
|
| Q |
301 |
gactattcaagcttacaatggaagcctcaccggaaacccgggtttatgcacgcttgatgctattggttccttcaagcgttgttctgagaatagtggcttg |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51821727 |
gactattcaagcttacaatggaagcctcaccggaaacccgggtttatgcacgcttgatgctattggttccttcaagcgttgttctgagaatagtggcttg |
51821628 |
T |
|
| Q |
401 |
tcaaaagatgtccgtgcccttgttct |
426 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
51821627 |
tcaaaagatgtccgtgcccttgttct |
51821602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University