View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11849_low_18 (Length: 363)
Name: NF11849_low_18
Description: NF11849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11849_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 7e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 7e-71
Query Start/End: Original strand, 154 - 326
Target Start/End: Complemental strand, 28416604 - 28416432
Alignment:
| Q |
154 |
gagatgagaaaattgatgtaggacaactgattgctcatagcttaaaggatatggttgcgaaaaggaaagagtgaatggtgaaccatctgatannnnnnna |
253 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28416604 |
gagatgagaaaattggtgtaggacaactgattgctcatagcttaaaggatatggttgggaaaaggaaagagtgaatggtgaaccatctgatatttttttg |
28416505 |
T |
|
| Q |
254 |
tgaagtcctagggtgctattaatgttacaaaaatgatggtgtatgagaagtatgaggacaagtacttgagagg |
326 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28416504 |
tgaagtcctagggtgctattaatgttacaaaaatgatggtgtatgagaagtatcaggacaagtacttgagagg |
28416432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University