View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11849_low_29 (Length: 233)
Name: NF11849_low_29
Description: NF11849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11849_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 9 - 218
Target Start/End: Complemental strand, 27971975 - 27971766
Alignment:
| Q |
9 |
gtggtgttggccagggaccttggattctgctcctctcaaggtttctggttcgattatgcgctgtgccaatttcggtgggatggtttggcctctttggaaa |
108 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27971975 |
gtggtgttggccagggaccttggagtctgctcctctcaaggtttctggttcgattatgcgcggtgccaatttcggtgggatggtttggccaatttggaaa |
27971876 |
T |
 |
| Q |
109 |
atgtttagggtgtactacacttaagtttcatttggtgtctttttgaggtattcatggaagttgaaaggttttgttatgttgtgtggctacaagctatttt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27971875 |
atgtttagggtgtactacacttaagtttcatttggtgtctttttgaggtattcatggaagttgaaaggttttgttatgttgtgtggctacaagctatttt |
27971776 |
T |
 |
| Q |
209 |
ttcaaatggt |
218 |
Q |
| |
|
|||||||||| |
|
|
| T |
27971775 |
ttcaaatggt |
27971766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 13 - 107
Target Start/End: Complemental strand, 37980199 - 37980105
Alignment:
| Q |
13 |
tgttggccagggaccttggattctgctcctctcaaggtttctggttcgattatgcgctgtgccaatttcggtgggatggtttggcctctttggaa |
107 |
Q |
| |
|
||||||| ||||||||||| | ||||||||||||||| || ||||||||| | | | ||| ||||||| | ||| | ||||||| ||||||||| |
|
|
| T |
37980199 |
tgttggcttgggaccttggagtgtgctcctctcaaggtctcaggttcgattctccccagtgtcaatttcagcgggctagtttggcttctttggaa |
37980105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 156 - 193
Target Start/End: Complemental strand, 27970828 - 27970791
Alignment:
| Q |
156 |
gtattcatggaagttgaaaggttttgttatgttgtgtg |
193 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
27970828 |
gtattcatggaagttgaagggttttgttgtgttgtgtg |
27970791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 9 - 96
Target Start/End: Original strand, 25384556 - 25384643
Alignment:
| Q |
9 |
gtggtgttggccagggaccttggattctgctcctctcaaggtttctggttcgattatgcgctgtgccaatttcggtgggatggtttgg |
96 |
Q |
| |
|
||||||||||| ||||||||||| | ||||||||||| ||| || ||||||||||||| | |||||||||| |||||| | |||||| |
|
|
| T |
25384556 |
gtggtgttggcttgggaccttggagtgtgctcctctcagggtctcgggttcgattatgctcggtgccaattttggtgggttagtttgg |
25384643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 22 - 97
Target Start/End: Complemental strand, 3697442 - 3697367
Alignment:
| Q |
22 |
gggaccttggattctgctcctctcaaggtttctggttcgattatgcgctgtgccaatttcggtgggatggtttggc |
97 |
Q |
| |
|
||||||||||| ||||||||||||||| |||||||||||| | | | ||||||||||||| ||| | ||||||| |
|
|
| T |
3697442 |
gggaccttggagagtgctcctctcaaggtctctggttcgattctcctcggtgccaatttcggcgggttagtttggc |
3697367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 10 - 87
Target Start/End: Original strand, 26482114 - 26482191
Alignment:
| Q |
10 |
tggtgttggccagggaccttggattctgctcctctcaaggtttctggttcgattatgcgctgtgccaatttcggtggg |
87 |
Q |
| |
|
|||||||||| ||||||| ||| | ||||||||||||||| || ||||||||| | | | ||||||||||| ||||| |
|
|
| T |
26482114 |
tggtgttggcttgggacctaggagtgtgctcctctcaaggtctcaggttcgattctcctcagtgccaatttcagtggg |
26482191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 102
Target Start/End: Complemental strand, 6099561 - 6099481
Alignment:
| Q |
22 |
gggaccttggattctgctcctctcaaggtttctggttcgattatgcgctgtgccaatttcggtgggatggtttggcctctt |
102 |
Q |
| |
|
||||||||||| | ||||||||||||||| || ||||||||| | | | ||||||| |||||||| | ||||||| |||| |
|
|
| T |
6099561 |
gggaccttggagtgtgctcctctcaaggtctcaggttcgattctccccgctgccaatatcggtgggctagtttggcttctt |
6099481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 9 - 102
Target Start/End: Complemental strand, 48125230 - 48125137
Alignment:
| Q |
9 |
gtggtgttggccagggaccttggattctgctcctctcaaggtttctggttcgattatgcgctgtgccaatttcggtgggatggtttggcctctt |
102 |
Q |
| |
|
||||||||||| ||||||||||| | |||||||| ||||| || ||||| ||| | | | ||||||||||||||||| | ||||||| |||| |
|
|
| T |
48125230 |
gtggtgttggcttgggaccttggagtgtgctcctccgaaggtctcaggttcaattttccccggtgccaatttcggtgggctagtttggcttctt |
48125137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 10 - 63
Target Start/End: Complemental strand, 31669079 - 31669026
Alignment:
| Q |
10 |
tggtgttggccagggaccttggattctgctcctctcaaggtttctggttcgatt |
63 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||| | ||||||||| |
|
|
| T |
31669079 |
tggtgttggcttgggaccttggagtctgctcctctcaaggtcttaggttcgatt |
31669026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 9 - 61
Target Start/End: Complemental strand, 42799803 - 42799751
Alignment:
| Q |
9 |
gtggtgttggccagggaccttggattctgctcctctcaaggtttctggttcga |
61 |
Q |
| |
|
||||||||||| ||||||||||| | ||||||||||||||| || ||||||| |
|
|
| T |
42799803 |
gtggtgttggcttgggaccttggagtgtgctcctctcaaggtctcaggttcga |
42799751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 102
Target Start/End: Original strand, 38939235 - 38939315
Alignment:
| Q |
22 |
gggaccttggattctgctcctctcaaggtttctggttcgattatgcgctgtgccaatttcggtgggatggtttggcctctt |
102 |
Q |
| |
|
||||||||||| | ||||||||||||||| ||||||| |||| | | | || ||||||||||||| | ||||||| |||| |
|
|
| T |
38939235 |
gggaccttggagtgtgctcctctcaaggtctctggtttgattctccccaatgtcaatttcggtgggctagtttggcttctt |
38939315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University