View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11849_low_6 (Length: 456)
Name: NF11849_low_6
Description: NF11849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11849_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-103; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 176 - 436
Target Start/End: Original strand, 15596016 - 15596271
Alignment:
| Q |
176 |
atctatgctatgctttgttatgttcttctcatttcactccgtttgtttctttaggttacgctctcaaaaccgggaaattgctcaactggattcccaaacc |
275 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
15596016 |
atctatgctatgcttcgttatgttattctcatttcactccgtttgtttctttaggttacgctctcaaaacctggaaattgctcaactggattcgcaaacc |
15596115 |
T |
 |
| Q |
276 |
ctgggtatgtaacgtagacgacgtctaatgattactgttacgtttatcgtttatgttgtctcgtcacttcctaaatcgacatcttgttgctttttccatc |
375 |
Q |
| |
|
|||| ||||||||||||||| || |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15596116 |
ctggatatgtaacgtagacg-cg--taatgattactgttactattatcgtttatgttgtctcgtcacttcctaaatcgacatct--ttgctttttccatc |
15596210 |
T |
 |
| Q |
376 |
acattatggctctgaacagctgttgataagctaggttatagcagatgtcagatgtacttat |
436 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| || |||||||||||||||||| |
|
|
| T |
15596211 |
acattatggctctgaacagctgttgataagctagcttatggcggatgtcagatgtacttat |
15596271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 7 - 154
Target Start/End: Original strand, 15595839 - 15595987
Alignment:
| Q |
7 |
cgacggtaataaatcttctcgtgaagaggattcttcttctgattctgtttccacggccctcgttcccgtcgctccttcacatttcactctcaaaaacatt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15595839 |
cgacggtaataaatcttctcgtgaagaggattcttcttctgactctgtttccacggccctcgttcccgtcgctccttcacatttcactctcaaaaacatt |
15595938 |
T |
 |
| Q |
107 |
gcaagt-aaatcgacctcttggatattctcatcgtagccggagttggta |
154 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15595939 |
gcaagtcaaatcgacctcttggatattctcatcgtagccggagttggta |
15595987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University