View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11850_high_18 (Length: 298)
Name: NF11850_high_18
Description: NF11850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11850_high_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 18 - 290
Target Start/End: Original strand, 28838706 - 28838978
Alignment:
| Q |
18 |
acagtactcattagttagacacaaagccttcgttagttaaagcactcattattgctgtcatttttagttcagtatgaaagtgtttttaatcatcaaaatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28838706 |
acagtactcattagttagacacaaagccttcgttagttaaagcactcattattgctgtcatttttagttcagtatgaaagtgtttttaatcatcaaaatt |
28838805 |
T |
 |
| Q |
118 |
atatacttgtgaatatgaatatcccctggtaaaattgtacactttaacccctttatatattccattccataaattcaagttacataaacttcagttctgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28838806 |
atatacttgtgaatatgaatatcccctggtaaaattgtacactttaacccctttatatattccattccataaattcaagttacataaacttcagttctgt |
28838905 |
T |
 |
| Q |
218 |
atcacttcatttgtaatacttctctaactcatttgatgtgatgcttcattctatgatgtgttcttgatgtcca |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28838906 |
atcacttcatttgtaatacttctctaactcatttgatgtgatgcttcattctatgatgtgttcttggtgtcca |
28838978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University