View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11850_low_11 (Length: 413)
Name: NF11850_low_11
Description: NF11850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11850_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 203 - 394
Target Start/End: Complemental strand, 31304059 - 31303874
Alignment:
| Q |
203 |
aatgggaaggttttggtgaagaagagagtgtttcgggtaagtaagggagaagaacaagagagggaaagtgaagtagccattgcagcttgcttcattggta |
302 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31304059 |
aatgagaaggttttggtgaagaagagagtgtttcgggtaagtaagggagaagaacaagagagggaaagtgaagtagccattgcagcttgcttcattggtt |
31303960 |
T |
|
| Q |
303 |
tttctctctctgctcctccaagtgcttagttaacactaacacgttaataatacgaatatatgtgagtgcgaaggataatacaagttggtctt |
394 |
Q |
| |
|
| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31303959 |
tctctctctctgctcctccaagtgcttagtta------acacgttaataatacgaatatatgtgagtgcgaaggataatacaagttggtctt |
31303874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 31304261 - 31304125
Alignment:
| Q |
1 |
gttagcaccaaaattggcagcgaagcgagaagcacggacacctccgcttccggcaccgatggtgaagaggtcgaaatcatagtggcgggtggggtcggct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || |||||||| |||||||||| |||||||||| | |
|
|
| T |
31304261 |
gttagcaccaaaattggcagcgaagcgagaagcacggacaccgccgcttccggcaccgatggtaaaaaggtcgaagtcatagtggccggtggggtcgacg |
31304162 |
T |
|
| Q |
101 |
ccgttttgggattcagcgcgaacggcgaaggtgcggc |
137 |
Q |
| |
|
|||||||| || |||||||| || || |||||||||| |
|
|
| T |
31304161 |
ccgttttgcgactcagcgcggaccgcaaaggtgcggc |
31304125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University