View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11850_low_12 (Length: 408)
Name: NF11850_low_12
Description: NF11850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11850_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 352; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 352; E-Value: 0
Query Start/End: Original strand, 15 - 388
Target Start/End: Complemental strand, 8413848 - 8413478
Alignment:
| Q |
15 |
tgagaggaaaatggcgaagcctttggaattcgaatctgaaaccaaaaaccgtaaactgttgcgcatggcggttgttacacgacggtccggacaccatcga |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8413848 |
tgagaggaaaatggcgaagcctttggaattcgaatctgaaaccaaaaaccgtaaactgttgcgcatggcggttgttacacgacggtccggacaccgtcga |
8413749 |
T |
 |
| Q |
115 |
ggagcttctcgaacggcatctagtgaagaaagttatcaacgatgatgaagaagaagaagagttgctgaatcggcggcgactcacaagcacgcgccgagaa |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8413748 |
ggagcttctcgaacggcatctagtgaagaaagttatcaacgatgatgaagaagaaga---gttgctgaatcggcggcgactcacaagcacgcgccgagaa |
8413652 |
T |
 |
| Q |
215 |
gcactgagtctctacagagacattcttcgtgcttcacgatttttcacatggcacgataccaaaggcgttctatggcgtgatcttctcaaggatagcgctc |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8413651 |
gcactgagtctctacagagacattcttcgtgcttcacgatttttcacatggcacgataccaaaggcgttctatggcgtgatcttcttaaggatagcgctc |
8413552 |
T |
 |
| Q |
315 |
gtaaagagtttgagcttgccaggtttgagacggatccagagattgtcactcggttgcttatcggtggacgtgag |
388 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8413551 |
gtaaagagtttgagcttgccaggtttgagacggatccagagattgtcactcggttgcttatcggtggacgtgag |
8413478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University