View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11850_low_14 (Length: 357)
Name: NF11850_low_14
Description: NF11850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11850_low_14 |
 | |
|
| [»] scaffold0043 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0043 (Bit Score: 173; Significance: 6e-93; HSPs: 2)
Name: scaffold0043
Description:
Target: scaffold0043; HSP #1
Raw Score: 173; E-Value: 6e-93
Query Start/End: Original strand, 164 - 344
Target Start/End: Complemental strand, 16947 - 16767
Alignment:
| Q |
164 |
aggtaatttagtctcttcactatgaagtgagatttgcagatatgtagatatagcaactaatgtcccatattggaagattagcgagtaagtagaggaaaat |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16947 |
aggtaatttagtctcttcactatgaagtgagatttgcagatatgtagatatagcaactaatgtcccatattggaagattagcgagtaagtagaggaaaat |
16848 |
T |
|
| Q |
264 |
tggctgtaaatatttggtgaagaggcttgcctaacatgcaaaaactccaactcgctcactagttgggcgtgtgatgtccat |
344 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
16847 |
tggctataaatatttggtgaagaggcttgcctaacatgcaaaaactccaactcgctcactagatgggcgtgtgatgtccat |
16767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0043; HSP #2
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 18 - 100
Target Start/End: Complemental strand, 17093 - 17011
Alignment:
| Q |
18 |
gaatatatttcactttggccgttgataaagaatttatgctcacatctgaataatgtttttgtacaacccctatatcaatattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17093 |
gaatatatttcactttggccgttgatgaagaatttatgctcacatctgaataatgtttttgtacaacccctatatcaatattt |
17011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University