View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11850_low_25 (Length: 239)
Name: NF11850_low_25
Description: NF11850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11850_low_25 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 12 - 239
Target Start/End: Complemental strand, 38931035 - 38930804
Alignment:
| Q |
12 |
agttgctccctctataattgacagaaacaacttttacgtgatattcctc---tctcccaccaaactcgttacaaacttgaacttgggcacatacaggaaa |
108 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
38931035 |
agttgctccctctatgattgacagaaacaacttttacgtgatattcctcctctctcccaccaaactcgttacaaacttgaacttgggcacatacaggaga |
38930936 |
T |
 |
| Q |
109 |
atatgtttcaatgataggttctactgg-catcaacctgaggttacaacaaccgatgtaatgaatttgaaacaagagggatgaatcagctacgaacttcat |
207 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38930935 |
atatgtttcaatgataggttctactgggcatcaacctgaggttacaacaaccgatgtaatgaatttgaaacaagagggatgaatcagctacgaacttcat |
38930836 |
T |
 |
| Q |
208 |
cgaaaggttccgaaggacggccggaaaatgtt |
239 |
Q |
| |
|
|||||||||| |||||||||| |||||||||| |
|
|
| T |
38930835 |
cgaaaggttcagaaggacggctggaaaatgtt |
38930804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University