View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11850_low_30 (Length: 217)
Name: NF11850_low_30
Description: NF11850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11850_low_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 9e-94; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 21 - 202
Target Start/End: Complemental strand, 47544028 - 47543847
Alignment:
| Q |
21 |
gaaggagctccagcagggccacactctacagataaataaaatacaaaagacggataacttttataaatttcccatgcaaatgttttctatgttaaacttc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47544028 |
gaaggagctccagcagggccacactctacagataaataaaatacaaaagacggataacttttataaatttcccatgcaaatgttttctatgttaaacttc |
47543929 |
T |
 |
| Q |
121 |
ataattgcatacaaatgtgtttaacaattcaaaccttttacagtaggctgaagtccaagttcataaggatcagatgtctgtg |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47543928 |
ataattgcatacaaatgtgtttaacaattcaaaccttttgcagtaggatgaagtccaagttcataaggatcagatgtctgtg |
47543847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 65 - 103
Target Start/End: Original strand, 10266914 - 10266952
Alignment:
| Q |
65 |
aaaagacggataacttttataaatttcccatgcaaatgt |
103 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10266914 |
aaaatacggataacttttataaatttcccatgcaaatgt |
10266952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University