View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11851_high_27 (Length: 434)
Name: NF11851_high_27
Description: NF11851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11851_high_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 129; Significance: 1e-66; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 276 - 420
Target Start/End: Complemental strand, 2704162 - 2704018
Alignment:
| Q |
276 |
gcttcaacttctgctgctgttcgtctctctcgtttcatcttctccgctctgctgcacaccgcaacacataaggtcaatacttttcgctctctatgaaact |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
2704162 |
gcttcaacttctgctgctgttcgtctctctcgtttcatcttctctgctctgctgcacaccgcaacatataaggtcgatacttttcgctctctatgaaact |
2704063 |
T |
 |
| Q |
376 |
atcaacttgatttcttctctgttcgttttgcttattccaaaagtg |
420 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2704062 |
atcaacttgatttcttctctgttctttttgcttattccaaaagtg |
2704018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 101 - 141
Target Start/End: Complemental strand, 2704338 - 2704298
Alignment:
| Q |
101 |
aaataactatttaacataatttgattccaggatgaatgtgt |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2704338 |
aaataactatttaacataatttgattccaggatgaatgtgt |
2704298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 2704457 - 2704422
Alignment:
| Q |
1 |
atttgttaatgttatattccattttgacttgttaaa |
36 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2704457 |
atttgttaatgttatattcctttttgacttgttaaa |
2704422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University