View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11851_high_55 (Length: 284)
Name: NF11851_high_55
Description: NF11851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11851_high_55 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 263
Target Start/End: Original strand, 42812305 - 42812567
Alignment:
| Q |
1 |
gaatcaaatcgagatcgaaacgattcaaagaacgagatacaatcatcaacaacgggattgacatcaggaatatgagcaattaaaccatcagagaaaccat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42812305 |
gaatcaaatcgagatcgaaacgattcaaagaacgagatacaatcatcaacaacgggattgacatcaggaatatgagcaattaaaccatcagagaaaccat |
42812404 |
T |
 |
| Q |
101 |
gaccttgatgatcaatagcgcaagtggcgaatccggctttagcaaagtagacggcggagagttggacagtccagctggattcgccggtgtagccgtggac |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42812405 |
gaccttgatgatcaatggcgcaagtggcgaatccggctttagcaaagtagacggcggagagttggacagtccagctggattcgccggtgtagccgtggac |
42812504 |
T |
 |
| Q |
201 |
gacggcgagggttccgataagtttagttggaggattagggatccaccactgagtgaagagttt |
263 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42812505 |
gacggcgagggttccgatgagtttggttggaggattagggatccaccactgagtgaagagttt |
42812567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University