View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11851_high_56 (Length: 282)
Name: NF11851_high_56
Description: NF11851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11851_high_56 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 7 - 271
Target Start/End: Original strand, 46865047 - 46865312
Alignment:
| Q |
7 |
gttacttgactgaaattttaatagtttggagtaatcttctgttaagcattggttctcttcgtaacctttcaggggccgtactccatactcataccaaata |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46865047 |
gttacttgactgaaattttaatagtttggagtaatcttctgttaagcatgggttctcttcgtaacctttcaggggccgtactccatactcgtaccaaata |
46865146 |
T |
|
| Q |
107 |
ttcgttagg-cctcgtggttacacaagtaggtactaaaattgcttttcagatatnnnnnnnngttggatagtactctactttggtatgtgtcgatggata |
205 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46865147 |
ttcgttaggtcctcgtggttacacaagtaggtaccaaaattgcttttcagatataaaaaaaagttggatagtactctactttggtatgtgtcgatggata |
46865246 |
T |
|
| Q |
206 |
ctctacttttcatatatggttaacgcagctgcagtgttagagactaaaaaaccttaacgtctctgc |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46865247 |
ctctacttttcatatatggttaacgcagctgcagtgttagagactaaaaaaccttaacgtctctgc |
46865312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University