View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11851_high_81 (Length: 210)

Name: NF11851_high_81
Description: NF11851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11851_high_81
NF11851_high_81
[»] chr3 (1 HSPs)
chr3 (20-192)||(29012489-29012661)


Alignment Details
Target: chr3 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 20 - 192
Target Start/End: Original strand, 29012489 - 29012661
Alignment:
20 aggtaatgatcaatcaatagcatagtccgccaagaaacaacggccatattcaagcatgaagaacattcataacaatgagtgatccgataattattatcaa 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||    
29012489 aggtaatgatcaatcaatagcatagtccgccaagaaacaacggccatattcaagcatgaagaacatgcataacaatgagtgat-cgataattattatcaa 29012587  T
120 atgcttgggacaac-nnnnnnngttttgaatggaggtgacaaacagtacgtcaaacagcttggggcatcttcat 192  Q
    ||||||||||||||        ||||||||||||||||||||||||||||||| |||||||| |||||||||||    
29012588 atgcttgggacaacttttttttgttttgaatggaggtgacaaacagtacgtcagacagcttgaggcatcttcat 29012661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University