View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11851_low_22 (Length: 457)
Name: NF11851_low_22
Description: NF11851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11851_low_22 |
 |  |
|
| [»] scaffold0236 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 71; Significance: 5e-32; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 309 - 447
Target Start/End: Complemental strand, 15840854 - 15840716
Alignment:
| Q |
309 |
gtggtgatgatgtcaggtgttgtttgtggcgatgagaaggcgaggagttgttattaggggctttagcgggggtgatggatttttggagtgactttggtgt |
408 |
Q |
| |
|
|||||||| ||| |||||| |||||||| |||| |||| ||||||||||||||||||| || |||| |||||||| ||| |||||||||||||||| | |
|
|
| T |
15840854 |
gtggtgataatgggaggtgtcgtttgtggtgatgcgaagttgaggagttgttattaggggtttcagcgagggtgatgcattattggagtgactttggtat |
15840755 |
T |
 |
| Q |
409 |
gagtagcggacgatggatgtttggattttgttttctgtg |
447 |
Q |
| |
|
||||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
15840754 |
gagtaacgaacgatagatgtttggattttgttttctgtg |
15840716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 325 - 441
Target Start/End: Original strand, 28006766 - 28006882
Alignment:
| Q |
325 |
gtgttgtttgtggcgatgagaaggcgaggagttgttattaggggctttagcgggggtgatggatttttggagtgactttggtgtgagtagcggacgatgg |
424 |
Q |
| |
|
||||||||||||| | |||||||| |||| ||||| ||||||| || |||||| |||||| ||| | ||||| |||||||||||||||||| ||| | |
|
|
| T |
28006766 |
gtgttgtttgtggtgttgagaaggtgaggtattgttgttaggggtttgagcgggtgtgatgattttcttgagtggctttggtgtgagtagcgggtgatag |
28006865 |
T |
 |
| Q |
425 |
atgtttggattttgttt |
441 |
Q |
| |
|
|||||| ||||||||| |
|
|
| T |
28006866 |
gtgtttgaattttgttt |
28006882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0236 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0236
Description:
Target: scaffold0236; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 330 - 441
Target Start/End: Complemental strand, 10303 - 10191
Alignment:
| Q |
330 |
gtttgtggcgatgagaaggcgaggagttgttattaggggcttt-agcgggggtgatggatttttggagtgactttggtgtgagtagcggacgatggatgt |
428 |
Q |
| |
|
|||| ||| |||||||||| |||| | |||| ||||||| || | |||| |||||| ||||||||||| ||||||||||||||| || ||| ||||| |
|
|
| T |
10303 |
gtttttggtgatgagaaggtgaggtgctgttgttaggggggttcaccgggtgtgatgattttttggagtggctttggtgtgagtagtgggcgacagatgt |
10204 |
T |
 |
| Q |
429 |
ttggattttgttt |
441 |
Q |
| |
|
||||||||||||| |
|
|
| T |
10203 |
ttggattttgttt |
10191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.00000000001; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 309 - 353
Target Start/End: Complemental strand, 7424850 - 7424806
Alignment:
| Q |
309 |
gtggtgatgatgtcaggtgttgtttgtggcgatgagaaggcgagg |
353 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
7424850 |
gtggtgatgatgtgaggtgttgtttgtggtgatgagaaggcgagg |
7424806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 309 - 367
Target Start/End: Original strand, 12220821 - 12220879
Alignment:
| Q |
309 |
gtggtgatgatgtcaggtgttgtttgtggcgatgagaaggcgaggagttgttattaggg |
367 |
Q |
| |
|
|||||||||| || ||||||||||||||| |||||||||||| |||| |||| |||||| |
|
|
| T |
12220821 |
gtggtgatgaggtgaggtgttgtttgtggtgatgagaaggcggggagctgttgttaggg |
12220879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000007; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 392 - 441
Target Start/End: Complemental strand, 15075140 - 15075091
Alignment:
| Q |
392 |
tggagtgactttggtgtgagtagcggacgatggatgtttggattttgttt |
441 |
Q |
| |
|
||||||| ||||||||||||||||||||||| | |||||| ||||||||| |
|
|
| T |
15075140 |
tggagtggctttggtgtgagtagcggacgatagctgtttgaattttgttt |
15075091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 392 - 440
Target Start/End: Complemental strand, 15065843 - 15065795
Alignment:
| Q |
392 |
tggagtgactttggtgtgagtagcggacgatggatgtttggattttgtt |
440 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
15065843 |
tggagtgactttggtgtgagtagcggacgataactgtttgaattttgtt |
15065795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000002; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 311 - 360
Target Start/End: Original strand, 26474994 - 26475043
Alignment:
| Q |
311 |
ggtgatgatgtcaggtgttgtttgtggcgatgagaaggcgaggagttgtt |
360 |
Q |
| |
|
|||||||| || ||||||||||||||| ||||||||| ||||| |||||| |
|
|
| T |
26474994 |
ggtgatgaggtgaggtgttgtttgtggtgatgagaagacgaggtgttgtt |
26475043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 101 - 137
Target Start/End: Original strand, 44755002 - 44755038
Alignment:
| Q |
101 |
gttggaaaaatatgacatagaattatcattaagtaat |
137 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
44755002 |
gttggaaaaatttgacatataattatcattaagtaat |
44755038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 402 - 443
Target Start/End: Complemental strand, 4554420 - 4554377
Alignment:
| Q |
402 |
ttggtgtgagtagcggacgatggatgtt--tggattttgttttc |
443 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4554420 |
ttggggtgagtagcggacgatggatgtttatggattttgttttc |
4554377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University