View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11851_low_46 (Length: 340)
Name: NF11851_low_46
Description: NF11851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11851_low_46 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 19 - 324
Target Start/End: Complemental strand, 31641400 - 31641095
Alignment:
| Q |
19 |
gtctcaccggaaagaacgacgatggtctcactagggactttcttggccttaccaacggtggaggaaatggtggtgactccttggatgtaaaggatatgct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31641400 |
gtctcaccggaaagaacgacgatggtctcactagggactttcttggccttaccaacggtggaggaaatggtggtgactccttggatgtaaaggatatgct |
31641301 |
T |
 |
| Q |
119 |
aacattcacggggggtgtagaataccaccaacaccaacctcatcaaaacatgatgatgctcaagtcacagtcacaacaagcaggttttggttttcttggg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31641300 |
aacattcacggggggtgtagaataccaccaacaccaacctcatcaaaacatgatgatgctcaagtcacagtcacaacaagcaggttttggttttcttggg |
31641201 |
T |
 |
| Q |
219 |
acaacaactgttcctgagtcgtgggggaactgttagagaccaaaattaccatgggtatatttggccattcaattcatctttagcattgtttctcttatat |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31641200 |
acaacaactgttcctgagtcgtgggggaactgttagacaccaaaattaccatgggtatatttggccattcaattcatctttagcattgtttctcttatat |
31641101 |
T |
 |
| Q |
319 |
accttc |
324 |
Q |
| |
|
|||||| |
|
|
| T |
31641100 |
accttc |
31641095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University