View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11851_low_53 (Length: 313)
Name: NF11851_low_53
Description: NF11851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11851_low_53 |
 | |
|
| [»] scaffold0204 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0204 (Bit Score: 147; Significance: 2e-77; HSPs: 1)
Name: scaffold0204
Description:
Target: scaffold0204; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 112 - 299
Target Start/End: Complemental strand, 16674 - 16495
Alignment:
| Q |
112 |
tgggtttgtattaatagtaagttaaacagcaccaaaacaaaaataaagaatacaagttaaatatttgtcaattgtgatgtactgtaaatcttagtatcat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
16674 |
tgggtttgtattaatagtaagttaaacagcaccaaaacaaaaataaagaatacaagttaaatatttgtcaattgtgatgtaatgtaaatcttagtatcat |
16575 |
T |
|
| Q |
212 |
atcttcaacgaacttacgagttacgtatattgaacccttaaacaacgttctagatccactagtcactagttagcttagcacagttctc |
299 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16574 |
atcttca--------acgagttacgtatattgaatccttaaacaacgttttagatccactagtcactagttagcttagcacagttctc |
16495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University