View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11851_low_55 (Length: 290)
Name: NF11851_low_55
Description: NF11851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11851_low_55 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 17 - 278
Target Start/End: Original strand, 33596507 - 33596770
Alignment:
| Q |
17 |
cagaaggtccctatccattgattagggaattgccaccttgtgcatattacaccaccaatttgtaaatatcttgttctggaaccaaaact--gtctccgta |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |
|
|
| T |
33596507 |
cagaaggtccctatccattgattagggaattgccaccttgtgcatattacaccaccaatttgtaaatatcttgttctggaaccaaaactttgtctctgta |
33596606 |
T |
 |
| Q |
115 |
atcagatcagtgataaccgctattattcaattgtttatataagcatgtggtgtatcatgaaaatgtcatgtgaagtaaggtacttgtatagtcagaataa |
214 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33596607 |
atcagatcaatgataaccgctattattcaattgtttatataagcatgtggtgtatcatgaaaatgtcatgtgaagtgaggtacttgtatagtcagaataa |
33596706 |
T |
 |
| Q |
215 |
gtaagttctcattttattatagaaaagaaaatcggcaattcaactcttcactacttctcattct |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33596707 |
gtaagttctcattttattatagaaaagaaaatcggcaattcaactcttcactactactcattct |
33596770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University