View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11851_low_60 (Length: 280)
Name: NF11851_low_60
Description: NF11851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11851_low_60 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 11 - 264
Target Start/End: Complemental strand, 35470555 - 35470303
Alignment:
| Q |
11 |
cataggtaaaacgccataaacacttagcctaccacaaaacacaaaaaggctagagactttgagatatatgtgaaagcttttgttggaaagctttcacata |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35470555 |
cataggtaaaacgccataaacacttagcctaccacaaaacacaaaaaggctggagactt-gagatatatgtgaaagcttgtgttggaaagctttcacata |
35470457 |
T |
|
| Q |
111 |
taaaacgtcaacagcctaaggctaacaagagaaagtcaaccacatggtttaaactaggttcaaaagttaggttggaacagtaatatatacacagcattct |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35470456 |
taaaacgtcaacagcctaaggctaacaagagaaagtcaaccacatggtttaaactaggttcaaaagttaggttggaacagttatatatacacagcattct |
35470357 |
T |
|
| Q |
211 |
gtctgtcatcacaagtctccagagaagcaggcttataagcctcaaacaaagaac |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35470356 |
gtctgtcatcacaagtctccagagaagcaggcttataagcctcaaacaaagaac |
35470303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University