View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11851_low_61 (Length: 280)
Name: NF11851_low_61
Description: NF11851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11851_low_61 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 8 - 280
Target Start/End: Complemental strand, 2937960 - 2937688
Alignment:
| Q |
8 |
cagagattgttattgccaagtggaacaactatggatatctgtttgtgttagttttctcaacactcactaccaaatgagtgtcaaccaggccagagtcatt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2937960 |
cagagattgttattgccaagtggaacaactatggatatctgtttgtgttagttttctcaacactcactaccaaatgagtgtcaaccaggccagagtcatt |
2937861 |
T |
|
| Q |
108 |
tggttgcaaaaattctttatgtttcttgtatggcgtaaacacaaaatcgcttgcatacattgagggattctttcatgttgttatatgatgcatgcatatt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2937860 |
tggttgcaaaaattctttatgtttcttgtatggcgtaaacacaaaatcgcttgcatacattgagggattctttcatattgttatatgatgcatgcatatt |
2937761 |
T |
|
| Q |
208 |
tacgtactactccttaattacaaacacaatagataacatggaatttcaaaactcaagtacctagagcagcaaa |
280 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
2937760 |
tacgtactactccttaattacagacacaatagataacatggaatttcaaaactgaagtacctagagcatcaaa |
2937688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University