View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11851_low_63 (Length: 273)
Name: NF11851_low_63
Description: NF11851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11851_low_63 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 14 - 258
Target Start/End: Complemental strand, 44605365 - 44605121
Alignment:
| Q |
14 |
agagaatattgcgatttgggattcaacatatatttgcatatttgcctgtaagaatcaaaggaaaatggacccctccgggtaaatttctacataacaggat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44605365 |
agagaatattgcgatttgggattcaacatatatttgcctatttgcctgtaagaatcgaaggaaaatggacccctccgggtaaatttctacataacaggat |
44605266 |
T |
|
| Q |
114 |
gaagtgtgatctcatacaaaaatggacgggtctatttctttccatcttaaatagtgcgagatttaaatagaagtataggacaaatgtaaaatacnnnnnn |
213 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44605265 |
gaagtgtgatctcatacaaaaatggatgggtctatttctttccatcttaaatagtgcgagatttaaatagaagtaaaggacaaatgtaaaatactttttt |
44605166 |
T |
|
| Q |
214 |
naggaacaaatgtaaaatgatgctaatacgttttttatttctttc |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44605165 |
taggaacaaatgtaaaatgatgctaatacgttttttatttctttc |
44605121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University