View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11851_low_63 (Length: 273)

Name: NF11851_low_63
Description: NF11851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11851_low_63
NF11851_low_63
[»] chr4 (1 HSPs)
chr4 (14-258)||(44605121-44605365)


Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 14 - 258
Target Start/End: Complemental strand, 44605365 - 44605121
Alignment:
14 agagaatattgcgatttgggattcaacatatatttgcatatttgcctgtaagaatcaaaggaaaatggacccctccgggtaaatttctacataacaggat 113  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
44605365 agagaatattgcgatttgggattcaacatatatttgcctatttgcctgtaagaatcgaaggaaaatggacccctccgggtaaatttctacataacaggat 44605266  T
114 gaagtgtgatctcatacaaaaatggacgggtctatttctttccatcttaaatagtgcgagatttaaatagaagtataggacaaatgtaaaatacnnnnnn 213  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||          
44605265 gaagtgtgatctcatacaaaaatggatgggtctatttctttccatcttaaatagtgcgagatttaaatagaagtaaaggacaaatgtaaaatactttttt 44605166  T
214 naggaacaaatgtaaaatgatgctaatacgttttttatttctttc 258  Q
     ||||||||||||||||||||||||||||||||||||||||||||    
44605165 taggaacaaatgtaaaatgatgctaatacgttttttatttctttc 44605121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University