View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11851_low_78 (Length: 239)
Name: NF11851_low_78
Description: NF11851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11851_low_78 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 10202714 - 10202837
Alignment:
| Q |
1 |
agagcgaacggttgttgctgtcatgagtgtttcgggtttggtgttgggtgggaggtcggagagggtgaccggaggaaggaagacgtgggaaatgccatga |
100 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10202714 |
agagcgaacggtggtggctgtcatgagtgtttcgggtttggtgttgggtgggaggtcggagagggtgatcggaggaaggaagacgtgggaaatgccatga |
10202813 |
T |
 |
| Q |
101 |
ggtagggaggtgagtacggtggtt |
124 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
10202814 |
ggtagggaggtgagtacggtggtt |
10202837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 21 - 120
Target Start/End: Original strand, 10209807 - 10209906
Alignment:
| Q |
21 |
tcatgagtgtttcgggtttggtgttgggtgggaggtcggagagggtgaccggaggaaggaagacgtgggaaatgccatgaggtagggaggtgagtacggt |
120 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10209807 |
tcatgagtggttcaggtttggtgttgggtgggaggtcggagagggtgaccggagggaggaagacgtgggaaatgccatgaggtagggaggtgagtacggt |
10209906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University