View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11851_low_79 (Length: 232)
Name: NF11851_low_79
Description: NF11851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11851_low_79 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 26219558 - 26219341
Alignment:
| Q |
1 |
gaaaatatgaagatcagttagagatttgaccatcttagccaacctgtgggcaacctcagttgcttgtcttctagtaaattcaacacactaatttgtaaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
26219558 |
gaaaatatgaagatcagttagagatgtgaccatcttagccaacgtgtgggcaacctcagttgcttgtcttctagtaaattcaacacaataatttgtaaaa |
26219459 |
T |
|
| Q |
101 |
atcgaaccatcaattctacgacaatcctgattcctgaaaaataacaccaaaatccgagttgtcttctcctctaataagaaatttggataccacattcaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26219458 |
atcgaaccatcaattctacgacaatcctgattcctgaaaaataacaccaaaatccgagttctcttctcctctagtaagaaatttggataccacattcaga |
26219359 |
T |
|
| Q |
201 |
gaatcaagttcaaaatct |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
26219358 |
gaatcaagttcaaaatct |
26219341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University