View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11851_low_83 (Length: 219)
Name: NF11851_low_83
Description: NF11851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11851_low_83 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 17 - 204
Target Start/End: Complemental strand, 44605308 - 44605121
Alignment:
| Q |
17 |
aaggaaaatggacccctccgggtaaatttctacataacaggatgaagtgtgatctcatacaaaaatggacgggtctatttctttccatcttaaatagtgc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44605308 |
aaggaaaatggacccctccgggtaaatttctacataacaggatgaagtgtgatctcatacaaaaatggatgggtctatttctttccatcttaaatagtgc |
44605209 |
T |
 |
| Q |
117 |
gagatttaaatagaagtataggacaaatgtaaaatacnnnnnnnaggaacaaatgtaaaatgatgctaatacgttttttatttctttc |
204 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44605208 |
gagatttaaatagaagtaaaggacaaatgtaaaatactttttttaggaacaaatgtaaaatgatgctaatacgttttttatttctttc |
44605121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University