View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11851_low_84 (Length: 214)
Name: NF11851_low_84
Description: NF11851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11851_low_84 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 18 - 186
Target Start/End: Original strand, 32136598 - 32136766
Alignment:
| Q |
18 |
agaagtatggtaatttttgtgacacaaagaaaggtttattttgtgtgcaaaaggacatttctcatttatgcttgagctagtaatggaaatgagtcaagct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32136598 |
agaagtatggtaatttttgtgacacaaagaaaggtttattttgtgtgcaaaaggacatttctcatttatgcttgagctagtaatggaattgagtcaagct |
32136697 |
T |
|
| Q |
118 |
aaacacaactagagaaaggatggaaaaaagagagtaacgttaagttgtgtattcacgtgaatgtttgta |
186 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32136698 |
aaacacaactagagaaaggaaggaaaacagagagtaacgttaagttgtgtattcacgtgaatgtttgta |
32136766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University