View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11851_low_86 (Length: 210)
Name: NF11851_low_86
Description: NF11851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11851_low_86 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 20 - 192
Target Start/End: Original strand, 29012489 - 29012661
Alignment:
| Q |
20 |
aggtaatgatcaatcaatagcatagtccgccaagaaacaacggccatattcaagcatgaagaacattcataacaatgagtgatccgataattattatcaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
29012489 |
aggtaatgatcaatcaatagcatagtccgccaagaaacaacggccatattcaagcatgaagaacatgcataacaatgagtgat-cgataattattatcaa |
29012587 |
T |
 |
| Q |
120 |
atgcttgggacaac-nnnnnnngttttgaatggaggtgacaaacagtacgtcaaacagcttggggcatcttcat |
192 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
29012588 |
atgcttgggacaacttttttttgttttgaatggaggtgacaaacagtacgtcagacagcttgaggcatcttcat |
29012661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University