View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11853_high_19 (Length: 517)
Name: NF11853_high_19
Description: NF11853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11853_high_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 406; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 406; E-Value: 0
Query Start/End: Original strand, 15 - 501
Target Start/End: Original strand, 403294 - 403792
Alignment:
| Q |
15 |
ggacatcaaaaatggataatttaaactacttcaatgtgtcggtgtcggacactaacacacatttcatggtgctacaga---------------gagaaag |
99 |
Q |
| |
|
||||||| ||||||||| ||||||||| | ||||||||||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
403294 |
ggacatcgaaaatggattatttaaact---tgaatgtgtcggtgtcggacactaacacagatttcatggtgctacagaagttgaatttccagagagaaag |
403390 |
T |
 |
| Q |
100 |
aaacctaacctgtaaccatgcaattggcctttagtaatagtagtaaccgtaacatgcgcaacataagtcatactagcaagcgcttcacctctaaacccca |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
403391 |
aaacctaacctgtaaccatgcaattggcctttagtaatagtagtaaccgtaacatgcgcaacataagtcatactagcaagcgcttcacctctaaacccca |
403490 |
T |
 |
| Q |
200 |
tagacgtaatcctctgcaaatcctcaaacgcagacaacttcgaagtcgtatgccgctcacacaaaatcggaagatcttcgcgtcgaataccgtgaccgtc |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
403491 |
tagacgtaatcctctgcaaatcctcaaacgcagacaacttcgaagtcgtatgccgctcacacaaaatcggaagatcttcgcgtcgaataccgtgaccgtc |
403590 |
T |
 |
| Q |
300 |
atcagagacttgaatcagtttcagaccgccgtctttgattgtaaggtttatggaagtggatgcggcgtcgaggctgttttcgacgagttcctttacggcg |
399 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
403591 |
atcggagacttgaatcagtttcagaccgccgtctttgattgtaaggtttatggaagtggatgcggcgtcgaggctgttttcgacgagttcctttacggcg |
403690 |
T |
 |
| Q |
400 |
gagactggacgttggattacctcgccggcggcgattcggttaacgactgattccgctaggcgttggattttgggtggcgactccatcttttacggtgttt |
499 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
403691 |
gagactggacgttggattacctcgccggcggcgattcggttaacgaccgattccgctaggcgttgaattttgggtggcgattccatcttttacggtgttt |
403790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University