View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11853_high_29 (Length: 365)

Name: NF11853_high_29
Description: NF11853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11853_high_29
NF11853_high_29
[»] chr7 (2 HSPs)
chr7 (149-348)||(6991148-6991352)
chr7 (18-113)||(6990906-6991001)


Alignment Details
Target: chr7 (Bit Score: 161; Significance: 8e-86; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 161; E-Value: 8e-86
Query Start/End: Original strand, 149 - 348
Target Start/End: Original strand, 6991148 - 6991352
Alignment:
149 taatgtcaagaccaatgtattggctcgaaaccctatttatctaacacagtac-----ccaaatgtcttatgcgaaaagttatcaaaagattgactgaacg 243  Q
    ||||||||||||||||||||||| ||||||||| |||||||||||||| |||     |||||||||||||||||||||||||||||||||||||||||||    
6991148 taatgtcaagaccaatgtattgggtcgaaaccccatttatctaacacattacattacccaaatgtcttatgcgaaaagttatcaaaagattgactgaacg 6991247  T
244 ttaaattataggccacgacttatcaatttaatatgtctaaagcaattaactagtgaacagtaatttcagttctcactctcctcttcggaaatggcggcga 343  Q
    ||||||||||||  |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6991248 ttaaattataggttacgactaatcaatttaatatgtctaaagcaattaactagtgaacagtaatttcagttctcactctcctcttcggaaatggcggcga 6991347  T
344 gctat 348  Q
    |||||    
6991348 gctat 6991352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 18 - 113
Target Start/End: Original strand, 6990906 - 6991001
Alignment:
18 ataacttatttttactagtttacaatggtgttcgataaattaattgaagtaacnnnnnnnnnnnnnatctaaattttatgcttgcaatcttaattg 113  Q
    ||||||||||||||||| ||||||||| |||| ||||||||||||||||||||             ||||||||||||||||||||||||||||||    
6990906 ataacttatttttactaatttacaatgatgttggataaattaattgaagtaacattttcattttttatctaaattttatgcttgcaatcttaattg 6991001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University