View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11853_high_34 (Length: 303)
Name: NF11853_high_34
Description: NF11853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11853_high_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 18 - 229
Target Start/End: Original strand, 5663523 - 5663734
Alignment:
| Q |
18 |
agtggattggtctgctattactactggtggcgatgaaaggacgttggagtttgctagacttaaaatttgtatgtttggcattgagtagaatccaaaatag |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |||| || |
|
|
| T |
5663523 |
agtggattggtctgctattactacgggtggcgatgaaaggacgttggagtttgctagacttaaaatttttacgtttggcattgagtagaatcaaaaacag |
5663622 |
T |
 |
| Q |
118 |
gtttattctattgtacttgatttatttctaattgtttttatgctactgttgttgtgattttttatcaatgcagtcaattttcaatagagctgcttctgta |
217 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5663623 |
gtttattctattgtccttgatttatttctaatggtttttatgctactgttgttgtcattttttatcaatgcagtcaattttcaatagagctgcttctgta |
5663722 |
T |
 |
| Q |
218 |
tactgttaattg |
229 |
Q |
| |
|
|| | ||||||| |
|
|
| T |
5663723 |
tatttttaattg |
5663734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University