View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11853_high_42 (Length: 241)
Name: NF11853_high_42
Description: NF11853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11853_high_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 27355420 - 27355655
Alignment:
| Q |
1 |
tgaactgtactgttccaactaacagtaacgggaaattgtagcaacaaggacaccgtttgtttttagggaaaatagaaaagaatttacaatttgtggcaaa |
100 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27355420 |
tgaactgtacttttccaactaacagtaaagggaaattgtagcaacaaggacaccgtttgtttttagggaaaatagaaaagaatttacaatttgttgcaaa |
27355519 |
T |
 |
| Q |
101 |
atcaatggaatcttaaatagggagaaaacaagaaagtaaacctcttnnnnnnnnnnnnnntagaaactagtaccaacaaggaagagcaaatacaacnnnn |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
27355520 |
atcaatggaatcttaaatagggagaaaacaagaaagtaaacctctaaaaaaaaataaaaatagaaactagtacaaacaaagaagagcaaatacaactttt |
27355619 |
T |
 |
| Q |
201 |
nnnaacaaggaaaaagttgagatgagttgaatccct |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
27355620 |
tttaacaaggaaaaagttgagatgagttgaatccct |
27355655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University