View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11853_high_47 (Length: 235)
Name: NF11853_high_47
Description: NF11853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11853_high_47 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 231; Significance: 1e-128; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 24328142 - 24327908
Alignment:
| Q |
1 |
gagaaaggaatctcaatgaaaaatgtaattctttcttcttgattggaatgctgcattccttagctgcatgcagatgatcaaagttgttgctacatacatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24328142 |
gagaaaggaatctcaatgaaaaatgtaattctttgttcttgattggaatgctgcattccttagctgcatgcagatgatcaaagttgttgctacatacatt |
24328043 |
T |
 |
| Q |
101 |
gagttcaatagttctttacagaacccttttgaaggaagaaaaatgctgctaaaagatgcaaatgctgcatagttttgaagggggtgtgtttataaacagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24328042 |
gagttcaatagttctttacagaacccttttgaaggaagaaaaatgctgctaaaagatgcaaatgctgcatagttttgaagggggtgtgtttataaacagt |
24327943 |
T |
 |
| Q |
201 |
gtgatatatcatatatgtattgttaatatattttt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
24327942 |
gtgatatatcatatatgtattgttaatatattttt |
24327908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 36 - 69
Target Start/End: Original strand, 24327531 - 24327564
Alignment:
| Q |
36 |
ttcttgattggaatgctgcattccttagctgcat |
69 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
24327531 |
ttcttgattagaatgctgcattccttagctgcat |
24327564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University